Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMF1 cdna clone

PSMF1 cDNA Clone

Gene Names
PSMF1; PI31
Synonyms
PSMF1; PSMF1 cDNA Clone; PSMF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggcctggaggtactgttcgcatcggcagcgccggccatcacctgcaggcaggacgcgctcgtctgcttcttgcattgggaagtggtgacacacggttactgcggcttgggtgtcggtgaccagccgggtcccaatgataagaagtcagaactgctgccagctgggtggaacaacaataaagacctgtatgtcctccggtatgagtataaggatgggtccagaaagctccttgtgaaagccatcaccgtggagagcagcatgatcctcaatgtgctggaatatggctcacagcaagtggcagacttgaccctgaacttggatgattatatcgatgcagaacacctgggtgacttccacaggacctacaagaacagtgaggagcttcggtctcgtattgtgtctggaatcatcacacctatccatgagcagtgggaaaaggctaatgtaagcagtccccaccgggagttcccccctgctaccgccagagaggtggacccactccggattcctccacaccacccacacaccagtcggcagcctccctggtgtgatcccctgggcccgtttgttgtcgggggagaagacttagacccttttgggcctcggagaggtggcatgattgtggatcccctgagatctggcttcccaagagcacttattgacccttcctcaggcctcccgaaccgacttcctccaggcgctgtgcccccaggagctcgctttgacccctttggacccattgggaccagcccacccggacctaacccagaccatctccccccgccgggctacgatgacatgtacctgtga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,817 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) inhibitor subunit 1 (PI31), mRNA
NCBI Official Synonym Full Names
proteasome inhibitor subunit 1
NCBI Official Symbol
PSMF1
NCBI Official Synonym Symbols
PI31
NCBI Protein Information
proteasome inhibitor PI31 subunit
UniProt Protein Name
Proteasome inhibitor PI31 subunit
Protein Family
UniProt Gene Name
PSMF1
UniProt Synonym Gene Names
hPI31
UniProt Entry Name
PSMF1_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a protein that inhibits the activation of the proteasome by the 11S and 19S regulators. Alternative transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PSMF1: Plays an important role in control of proteasome function. Inhibits the hydrolysis of protein and peptide substrates by the 20S proteasome. Also inhibits the activation of the proteasome by the proteasome regulatory proteins PA700 and PA28. Belongs to the proteasome inhibitor PI31 family.

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytosol; endoplasmic reticulum; membrane; nucleoplasm

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMF1

Similar Products

Product Notes

The PSMF1 psmf1 (Catalog #AAA1270834) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggcc tggaggtact gttcgcatcg gcagcgccgg ccatcacctg caggcaggac gcgctcgtct gcttcttgca ttgggaagtg gtgacacacg gttactgcgg cttgggtgtc ggtgaccagc cgggtcccaa tgataagaag tcagaactgc tgccagctgg gtggaacaac aataaagacc tgtatgtcct ccggtatgag tataaggatg ggtccagaaa gctccttgtg aaagccatca ccgtggagag cagcatgatc ctcaatgtgc tggaatatgg ctcacagcaa gtggcagact tgaccctgaa cttggatgat tatatcgatg cagaacacct gggtgacttc cacaggacct acaagaacag tgaggagctt cggtctcgta ttgtgtctgg aatcatcaca cctatccatg agcagtggga aaaggctaat gtaagcagtc cccaccggga gttcccccct gctaccgcca gagaggtgga cccactccgg attcctccac accacccaca caccagtcgg cagcctccct ggtgtgatcc cctgggcccg tttgttgtcg ggggagaaga cttagaccct tttgggcctc ggagaggtgg catgattgtg gatcccctga gatctggctt cccaagagca cttattgacc cttcctcagg cctcccgaac cgacttcctc caggcgctgt gcccccagga gctcgctttg acccctttgg acccattggg accagcccac ccggacctaa cccagaccat ctccccccgc cgggctacga tgacatgtac ctgtga. It is sometimes possible for the material contained within the vial of "PSMF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.