PARP11 cdna clone
PARP11 cDNA Clone
Gene Names
PARP11; ARTD11; MIB006; C12orf6
Synonyms
PARP11; PARP11 cDNA Clone; PARP11 cdna clone
Sequence
atgtttcacaaagcagaagaattattttctaaaacaacaaacaatgaagtggatgacatggacacgtcagatacccagtggggctggttttacttggcagaatgtgggaagtggcacatgtttcagccggataccaacagtcagtgttcagttagcagtgaagatatcgaaaaaagcttcaaaacaaacccttgtggctccatttcttttactacttccaaattcagctacaagatagactttgcagaaatgaagcaaatgaatctcaccactggaaagcagcgcttaataaaaagagcccccttttctatcagtgctttcagttacatctgtgaaaacgaggccatccctatgccaccacactgggagaatgtgaatactcaagtaccatatcagcttattcctctgcacaatcaaacacatgaatataatgaagttgctaatctctttgggaagacgatggatcgcaaccgaattaaaagaattcagagaattcaaaacctagatttgtgggagttcttttgcaggaaaaaggctcagctcaagaaaaaaagaggtgtgcctcagattaatgaacaaatgctgtttcatggtaccagcagtgaatttgtggaagcaatctgcattcataactttgattggagaataaatggtatacatggtgctgtctttggaaaagataacatgtggaagctgtag
Sequence Length
699
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,597 Da
NCBI Official Full Name
Homo sapiens poly (ADP-ribose) polymerase family, member 11, mRNA
NCBI Official Synonym Full Names
poly(ADP-ribose) polymerase family member 11
NCBI Official Symbol
PARP11
NCBI Official Synonym Symbols
ARTD11; MIB006; C12orf6
NCBI Protein Information
poly [ADP-ribose] polymerase 11
UniProt Protein Name
Poly [ADP-ribose] polymerase 11
Protein Family
UniProt Gene Name
PARP11
UniProt Synonym Gene Names
C12orf6; PARP-11; ARTD11
UniProt Entry Name
PAR11_HUMAN
Uniprot Description
PARP11: 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Transferase; EC 2.4.2.30
Chromosomal Location of Human Ortholog: 12p13.3
Cellular Component: nuclear envelope
Molecular Function: NAD+ ADP-ribosyltransferase activity
Research Articles on PARP11
Similar Products
Product Notes
The PARP11 parp11 (Catalog #AAA1269355) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttcaca aagcagaaga attattttct aaaacaacaa acaatgaagt ggatgacatg gacacgtcag atacccagtg gggctggttt tacttggcag aatgtgggaa gtggcacatg tttcagccgg ataccaacag tcagtgttca gttagcagtg aagatatcga aaaaagcttc aaaacaaacc cttgtggctc catttctttt actacttcca aattcagcta caagatagac tttgcagaaa tgaagcaaat gaatctcacc actggaaagc agcgcttaat aaaaagagcc cccttttcta tcagtgcttt cagttacatc tgtgaaaacg aggccatccc tatgccacca cactgggaga atgtgaatac tcaagtacca tatcagctta ttcctctgca caatcaaaca catgaatata atgaagttgc taatctcttt gggaagacga tggatcgcaa ccgaattaaa agaattcaga gaattcaaaa cctagatttg tgggagttct tttgcaggaa aaaggctcag ctcaagaaaa aaagaggtgt gcctcagatt aatgaacaaa tgctgtttca tggtaccagc agtgaatttg tggaagcaat ctgcattcat aactttgatt ggagaataaa tggtatacat ggtgctgtct ttggaaaaga taacatgtgg aagctgtag. It is sometimes possible for the material contained within the vial of "PARP11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
