Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPIHBP1 cdna clone

GPIHBP1 cDNA Clone

Gene Names
GPIHBP1; HYPL1D; GPI-HBP1
Synonyms
GPIHBP1; GPIHBP1 cDNA Clone; GPIHBP1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTGCGGGCGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTTGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA
Sequence Length
555
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,806 Da
NCBI Official Full Name
Homo sapiens glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1, mRNA
NCBI Official Synonym Full Names
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1
NCBI Official Symbol
GPIHBP1
NCBI Official Synonym Symbols
HYPL1D; GPI-HBP1
NCBI Protein Information
glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1
UniProt Protein Name
Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1
UniProt Gene Name
GPIHBP1
UniProt Synonym Gene Names
HBP1; GPI-HBP1; GPI-anchored HDL-binding protein 1
UniProt Entry Name
HDBP1_HUMAN

NCBI Description

This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Uniprot Description

GPIHBP1: Plays a key role in the lipolytic processing of chylomicrons.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: anchored to external side of plasma membrane; apical plasma membrane; basolateral plasma membrane; external side of plasma membrane

Molecular Function: protein transmembrane transporter activity

Biological Process: cholesterol homeostasis; intracellular protein transport; positive regulation of lipoprotein lipase activity; protein import; protein stabilization; transcytosis

Disease: Hyperlipoproteinemia, Type Id

Research Articles on GPIHBP1

Similar Products

Product Notes

The GPIHBP1 gpihbp1 (Catalog #AAA1278034) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAGGCGC TCGGGGCTGT CCTGCTTGCC CTCTTGCTGT GCGGGCGGCC AGGGAGAGGG CAGACACAGC AGGAGGAAGA GGAAGAGGAC GAGGACCACG GGCCAGATGA CTACGACGAG GAAGATGAGG ATGAGGTTGA AGAGGAGGAG ACCAACAGGC TCCCTGGTGG CAGGAGCAGA GTGCTGCTGC GGTGCTACAC CTGCAAGTCC CTGCCCAGGG ACGAGCGCTG CAACCTGACG CAGAACTGCT CACATGGCCA GACCTGCACA ACCCTCATTG CCCACGGGAA CACCGAGTCA GGCCTCCTGA CCACCCACTC CACGTGGTGC ACAGACAGCT GCCAGCCCAT CACCAAGACG GTGGAGGGGA CCCAGGTGAC CATGACCTGC TGCCAGTCCA GCCTGTGCAA TGTCCCACCC TGGCAAAGCT CCCGAGTCCA GGACCCAACA GGCAAGGGGG CAGGCGGCCC CCGGGGCAGC TCCGAAACTG TGGGCGCAGC CCTCCTGCTC AACCTCCTTG CCGGCCTTGG AGCAATGGGG GCCAGGAGAC CCTGA. It is sometimes possible for the material contained within the vial of "GPIHBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.