Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZFHX3 cdna clone

ZFHX3 cDNA Clone

Gene Names
ZFHX3; ATBT; ATBF1; ZNF927
Synonyms
ZFHX3; ZFHX3 cDNA Clone; ZFHX3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggctcgggggcgggcagctggtgtcagaggagctgatgaacctgggcgagagcttcatccagaccaacgacccgtcgctgaagctcttccagtgcgccgtctgcaacaagttcacgacggacaacctggacatgctgggcctgcacatgaacgtggagcgcagcctgtcggaggacgagtggaaggcggtgatgggggactcataccagtgcaagctctgccgctacaacacccagctcaaggccaacttccagctgcactgcaagacagacaagcacgtgcagaagtaccagctggtggcccacatcaaggagggcggcaaggccaacgagtggaggctcaagtgtgtggccatcggcaaccccgtgcacctcaagtgcaacgcctgtgactactacaccaacagcctggagaagctgcggctgcacacggtcaactccaggcacgaggccagcctgaagttgtacaagcacctgcagcagcatgagagtggtgtagaaggtgagagctgctactaccactgcgttctgtgcaactactccaccaaggccaagctcaacctcatccagcatgtgcgctccatgaagcaccagcgaagcgagagcctgcgaaagctgcagcggctgcagaagggccttccagaggaggacgaggacctggggcagatcttcaccatccgcaggtgcccctccacggacccagaagaagccattgaagatgttgaaggacccagtgaaacagctgctgatccagaggagcttgctaaggaccaagagggcggagcatcgtccagccaagcagagaaggagctgacagattctcctgcaacctccaaacgcatctccttcccaggtagctcagagtctcccctctcttcgaagcgaccaaaaacagctgaggagatcaaaccggagcagatgtaccagtgtccctactgcaagtacagtaatgccgatgtcaaccggctccgggtgcatgccatgacgcagcactcggtgcaacccatgcttcgctgccccctgtgccaggacatgctcaacaacaagatccacctccagctgcacctcacccacctccacagcgtggcacctgactgcgtggagaagctcattatgacggtgaccacccctgagatggtgatgccaagcagcatgttcctcccagcagctgttccagatcgagatgggaattccaatttggaagaggcaggaaagcagcctgaaacctcagaggatctgggaaagaacatcttgccatccgcaagcacagagcaaagcggagatttgaaaccatcccctgctgacccaggctctgtgagagaagactcaggcttcatctgctggaagaaggggtgcaaccaggttttcaaaacttctgctgcccttcagacgcattttaatgaagtgcatgccaagaggcctcagctgccggtgtcagatcgccatgtgtacaagtaccgctgtaatcagtgtagcctggccttcaagaccattgaaaagttgcagctccattctcagtaccatgtgatcagagctgccaccatgtgctgtctttgtcagcgcagtttccgaactttccaggctctgaagaagcaccttgagacaagccacctggagctgagtgaggctgacatccaacagctttatggtggcctgctggccaatggggacctcctggcaatgggagaccccactctggctgaggaccataccataattgttgaggaagacaaggaggaagagagtgacttggaagataaacagagcccaacgggcagtgactctgggtcagtacaagaagactcgggctcagagccaaagagagctctgcctttcagaaaaggtcccaattttactatggaaaagttcctagacccttctcgcccttacaagtgtaccgtctgcaaggaatctttcactcaaaagaatatcctgctagtacactacaattctgtctcccacctgcataagttaaagagagcccttcaagaatcagcaaccggtcagccagaacccaccagcagcccagacaacaaaccttttaagtgtaacacttgtaatgtggcctacagccagagttccactctggagatccatatgaggtctgtgttacatcaaaccaaggcccgggcagccaagctggaggctgcaagtggcagcagcaatgggactgggaacagcagcagtatttccttgagctcctccacgccaagtcctgtgagcaccagtggcagtaacacctttaccacctccaatccaagcagtgctggcattgctccaagctctaacttactaagccaagtgcccactgagagtgtagggatgccacccctggggaatcctattggtgccaacattgcttccccttcagagcccaaagaggccaatcggaagaaactggcagatatgattgcatccaggcagcagcaacaacagcagcagcaacagcaacaacaacaacaacaacaacaacaacaagcacaaacgctggcccaggcccaggctcaagttcaagctcacctgcagcaggagctgcagcaacaggctgccctgatccagtctcagctgtttaaccccaccctccttcctcacttccccatgacaactgagaccctgctgcaactacagcagcagcagcaccccctctaccccctctag
Sequence Length
2661
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
463
Molecular Weight
306,664 Da
NCBI Official Full Name
Homo sapiens zinc finger homeobox 3, mRNA
NCBI Official Synonym Full Names
zinc finger homeobox 3
NCBI Official Symbol
ZFHX3
NCBI Official Synonym Symbols
ATBT; ATBF1; ZNF927
NCBI Protein Information
zinc finger homeobox protein 3
UniProt Protein Name
Zinc finger homeobox protein 3
UniProt Gene Name
ZFHX3
UniProt Synonym Gene Names
ATBF1; ZFH-3
UniProt Entry Name
ZFHX3_HUMAN

NCBI Description

This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

ATBF1: Transcriptional repressor. It inhibits the enhancer element of the AFP gene by binding to its AT-rich core sequence. Regulator of myoblasts differentiation through the binding to the AT-rich sequence of MYF6 promoter and promoter repression. Down- regulates the MUC5AC promoter in gastric cancer. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; DNA-binding; C2H2-type zinc finger protein; Transcription factor; Cell development/differentiation

Chromosomal Location of Human Ortholog: 16q22.3

Cellular Component: cytoplasm; intracellular membrane-bound organelle; nuclear body; nucleolus; nucleoplasm; nucleus; transcription factor complex

Molecular Function: enzyme binding; protein binding; RNA polymerase II transcription factor activity, enhancer binding

Biological Process: circadian regulation of gene expression; negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent; transcription from RNA polymerase II promoter

Disease: Prostate Cancer

Research Articles on ZFHX3

Similar Products

Product Notes

The ZFHX3 zfhx3 (Catalog #AAA1273141) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggctcg ggggcgggca gctggtgtca gaggagctga tgaacctggg cgagagcttc atccagacca acgacccgtc gctgaagctc ttccagtgcg ccgtctgcaa caagttcacg acggacaacc tggacatgct gggcctgcac atgaacgtgg agcgcagcct gtcggaggac gagtggaagg cggtgatggg ggactcatac cagtgcaagc tctgccgcta caacacccag ctcaaggcca acttccagct gcactgcaag acagacaagc acgtgcagaa gtaccagctg gtggcccaca tcaaggaggg cggcaaggcc aacgagtgga ggctcaagtg tgtggccatc ggcaaccccg tgcacctcaa gtgcaacgcc tgtgactact acaccaacag cctggagaag ctgcggctgc acacggtcaa ctccaggcac gaggccagcc tgaagttgta caagcacctg cagcagcatg agagtggtgt agaaggtgag agctgctact accactgcgt tctgtgcaac tactccacca aggccaagct caacctcatc cagcatgtgc gctccatgaa gcaccagcga agcgagagcc tgcgaaagct gcagcggctg cagaagggcc ttccagagga ggacgaggac ctggggcaga tcttcaccat ccgcaggtgc ccctccacgg acccagaaga agccattgaa gatgttgaag gacccagtga aacagctgct gatccagagg agcttgctaa ggaccaagag ggcggagcat cgtccagcca agcagagaag gagctgacag attctcctgc aacctccaaa cgcatctcct tcccaggtag ctcagagtct cccctctctt cgaagcgacc aaaaacagct gaggagatca aaccggagca gatgtaccag tgtccctact gcaagtacag taatgccgat gtcaaccggc tccgggtgca tgccatgacg cagcactcgg tgcaacccat gcttcgctgc cccctgtgcc aggacatgct caacaacaag atccacctcc agctgcacct cacccacctc cacagcgtgg cacctgactg cgtggagaag ctcattatga cggtgaccac ccctgagatg gtgatgccaa gcagcatgtt cctcccagca gctgttccag atcgagatgg gaattccaat ttggaagagg caggaaagca gcctgaaacc tcagaggatc tgggaaagaa catcttgcca tccgcaagca cagagcaaag cggagatttg aaaccatccc ctgctgaccc aggctctgtg agagaagact caggcttcat ctgctggaag aaggggtgca accaggtttt caaaacttct gctgcccttc agacgcattt taatgaagtg catgccaaga ggcctcagct gccggtgtca gatcgccatg tgtacaagta ccgctgtaat cagtgtagcc tggccttcaa gaccattgaa aagttgcagc tccattctca gtaccatgtg atcagagctg ccaccatgtg ctgtctttgt cagcgcagtt tccgaacttt ccaggctctg aagaagcacc ttgagacaag ccacctggag ctgagtgagg ctgacatcca acagctttat ggtggcctgc tggccaatgg ggacctcctg gcaatgggag accccactct ggctgaggac cataccataa ttgttgagga agacaaggag gaagagagtg acttggaaga taaacagagc ccaacgggca gtgactctgg gtcagtacaa gaagactcgg gctcagagcc aaagagagct ctgcctttca gaaaaggtcc caattttact atggaaaagt tcctagaccc ttctcgccct tacaagtgta ccgtctgcaa ggaatctttc actcaaaaga atatcctgct agtacactac aattctgtct cccacctgca taagttaaag agagcccttc aagaatcagc aaccggtcag ccagaaccca ccagcagccc agacaacaaa ccttttaagt gtaacacttg taatgtggcc tacagccaga gttccactct ggagatccat atgaggtctg tgttacatca aaccaaggcc cgggcagcca agctggaggc tgcaagtggc agcagcaatg ggactgggaa cagcagcagt atttccttga gctcctccac gccaagtcct gtgagcacca gtggcagtaa cacctttacc acctccaatc caagcagtgc tggcattgct ccaagctcta acttactaag ccaagtgccc actgagagtg tagggatgcc acccctgggg aatcctattg gtgccaacat tgcttcccct tcagagccca aagaggccaa tcggaagaaa ctggcagata tgattgcatc caggcagcag caacaacagc agcagcaaca gcaacaacaa caacaacaac aacaacaaca agcacaaacg ctggcccagg cccaggctca agttcaagct cacctgcagc aggagctgca gcaacaggct gccctgatcc agtctcagct gtttaacccc accctccttc ctcacttccc catgacaact gagaccctgc tgcaactaca gcagcagcag caccccctct accccctcta g. It is sometimes possible for the material contained within the vial of "ZFHX3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.