TRIM7 cdna clone
TRIM7 cDNA Clone
Gene Names
TRIM7; GNIP; RNF90
Synonyms
TRIM7; TRIM7 cDNA Clone; TRIM7 cdna clone
Sequence
atggcggctgtgggaccgcggaccggccccggaaccggcgccgaggctctagcgctggcggcagagctgcagggcgaggcgacgtgctccatctgcctagagctctttcgtgagccggtgtccgtcgagtgcggccacagcttctgccgcgcctgcatagggcgctgctgggagcgcccgggcgcggggtctgttggggccgccacccgcgcgccccccttcccactgccctgtccgcagtgccgcgagcccgcgcgccccagtcagctgcggcccaaccggcagctggcggcagtggccacgctcctgcggcgcttcagcctgcccgcggctgccccgggagagcacgggtctcaggcggccgcggcccgggcagcggctgcccgctgcgggcagcatggcgaacccttcaagctctactgccaggacgacggacgcgccatctgcgtggtgtgcgaccgcgcccgcgagcaccgcgagcacgccgtgctgccgctggacgaggcggtgcaggaggccaaggagctcttggagtccaggctgagggtcttgaagaaggaactggaggactgtgaggtgttccggtccacggaaaagaaggagagcaaggagctgctgaaacagatggcagcggagcaggagaaggtgggggcagagttccaggcactgagggctttcctggtggagcaggagggtcggctgctaggccgcctggaggaactgtcccgggaggtggcacagaagcagaatgagaacctggcccagctcggggttgagatcacccagctgtccaagctcagcagccagatccaggagacagctcaaaagcctgaccttgactttctccaggaattcaaaagcacgctgagcaggtgtagcaatgtgcctggccccaagccaaccacagtctcttctgagatgaagaataaagtctggaatgtttctctcaagacctttgtcttaaaagggatgctgaagaagttcaaagaggaccttcggggagagctggagaaagaggagaaagtggagctcaccttggatcccgacacggccaacccgcgcctcatcctctctctggatcttaagggcgtgcgcctcggcgagcgggcccaggacctgcccaaccacccctgccgcttcgacaccaacacccgcgtcctggcgtcctgcggcttctcctcgggccggcatcactgggaggtggaggtgggctctaaggacggctgggcctttggcgtggcccgcgagagcgtgcgccgaaagggcctgacgcccttcactcccgaggagggcgtctgggccctgcagctcaacggcggccagtactgggccgtgaccagccccgagcggtcgcccctcagctgcgggcacctgtcgcgcgtgcgggtggccctggacctggaggtgggagccgtgtccttctacgctgtggaggacatgcgccacctctacaccttccgcgtcaacttccaggagcgcgtgttcccgcttttctctgtttgctccacgggcacctacttgcgaatctggccttga
Sequence Length
1536
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,700 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 7, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 7
NCBI Official Symbol
TRIM7
NCBI Official Synonym Symbols
GNIP; RNF90
NCBI Protein Information
tripartite motif-containing protein 7
UniProt Protein Name
Tripartite motif-containing protein 7
Protein Family
UniProt Gene Name
TRIM7
UniProt Synonym Gene Names
GNIP; RNF90
UniProt Entry Name
TRIM7_HUMAN
NCBI Description
The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Uniprot Description
TRIM7: is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Multiple transcript variants have been found for this gene, and some of them encode the same isoform. [provided by RefSeq, Jul 2008]
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 5q35.3
Cellular Component: cytoplasm; nucleus
Molecular Function: protein binding
Research Articles on TRIM7
Similar Products
Product Notes
The TRIM7 trim7 (Catalog #AAA1276676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg tgggaccgcg gaccggcccc ggaaccggcg ccgaggctct agcgctggcg gcagagctgc agggcgaggc gacgtgctcc atctgcctag agctctttcg tgagccggtg tccgtcgagt gcggccacag cttctgccgc gcctgcatag ggcgctgctg ggagcgcccg ggcgcggggt ctgttggggc cgccacccgc gcgcccccct tcccactgcc ctgtccgcag tgccgcgagc ccgcgcgccc cagtcagctg cggcccaacc ggcagctggc ggcagtggcc acgctcctgc ggcgcttcag cctgcccgcg gctgccccgg gagagcacgg gtctcaggcg gccgcggccc gggcagcggc tgcccgctgc gggcagcatg gcgaaccctt caagctctac tgccaggacg acggacgcgc catctgcgtg gtgtgcgacc gcgcccgcga gcaccgcgag cacgccgtgc tgccgctgga cgaggcggtg caggaggcca aggagctctt ggagtccagg ctgagggtct tgaagaagga actggaggac tgtgaggtgt tccggtccac ggaaaagaag gagagcaagg agctgctgaa acagatggca gcggagcagg agaaggtggg ggcagagttc caggcactga gggctttcct ggtggagcag gagggtcggc tgctaggccg cctggaggaa ctgtcccggg aggtggcaca gaagcagaat gagaacctgg cccagctcgg ggttgagatc acccagctgt ccaagctcag cagccagatc caggagacag ctcaaaagcc tgaccttgac tttctccagg aattcaaaag cacgctgagc aggtgtagca atgtgcctgg ccccaagcca accacagtct cttctgagat gaagaataaa gtctggaatg tttctctcaa gacctttgtc ttaaaaggga tgctgaagaa gttcaaagag gaccttcggg gagagctgga gaaagaggag aaagtggagc tcaccttgga tcccgacacg gccaacccgc gcctcatcct ctctctggat cttaagggcg tgcgcctcgg cgagcgggcc caggacctgc ccaaccaccc ctgccgcttc gacaccaaca cccgcgtcct ggcgtcctgc ggcttctcct cgggccggca tcactgggag gtggaggtgg gctctaagga cggctgggcc tttggcgtgg cccgcgagag cgtgcgccga aagggcctga cgcccttcac tcccgaggag ggcgtctggg ccctgcagct caacggcggc cagtactggg ccgtgaccag ccccgagcgg tcgcccctca gctgcgggca cctgtcgcgc gtgcgggtgg ccctggacct ggaggtggga gccgtgtcct tctacgctgt ggaggacatg cgccacctct acaccttccg cgtcaacttc caggagcgcg tgttcccgct tttctctgtt tgctccacgg gcacctactt gcgaatctgg ccttga. It is sometimes possible for the material contained within the vial of "TRIM7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
