Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF34 cdna clone

RNF34 cDNA Clone

Gene Names
RNF34; RFI; RIF; RIFF; hRFI; CARP1; CARP-1
Synonyms
RNF34; RNF34 cDNA Clone; RNF34 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcgggtgccacgtctatgtgggcttcgtgctgtgggctgctgaatgaagtcatgggaactggagctgtcaggggccagcagtcagcatttgcaggagccaccggtccattcagatttacaccaaaccctgagttttccacctacccaccagcagctacggaagggcccaacatagtttgtaaagcctgtgggctttcattttcagtctttagaaagaagcatgtttgctgtgactgcaagaaggatttttgctccgtttgttcagtcttacaagaaaatctccgtagatgttctacttgtcacttattacaagagacagcatttcagcgccctcagttaatgcgactgaaggtgaaggacctgcggcagtatctcattctgagaaatatacccatagatacttgtcgtgagaaagaagacttggtggatctagtactgtgccatcatggactaggctctgaggacgacatggacacaagcagtctgaattcttcaaggtcccagacttctagcttttttacacgttcgtttttttcaaactatacagccccctctgctactatgtcttcgtttcagggagagcttatggatggagaccaaacatccagatctggagtgccggcacaggtacaaagtgaaatcacttcagcaaacacagaagatgatgatgacgacgatgatgaggatgatgatgatgaagaagaaaacgcagaggatcggaaccccgggctctccaaggagagagtgagagcttcactgtctgacttgtcaagccttgatgatgtggaaggaatgagcgtgcgccagctgaaggaaattctggctcggaattttgtcaactattctggctgttgtgaaaaatgggaactggtagagaaagtaaaccggttatacaaagagaatgaagaaaaccaaaagtcctatggcgagcggctgcagctgcaggatgaggaagacgacagcctgtgtcgcatctgcatggatgccgtcatcgactgtgtcctactggagtgtgggcacatggttacctgcaccaagtgcggcaagcgcatgagtgagtgtcccatctgccggcagtatgtggtgcgagccgtgcacgtgttcaagtcctga
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,797 Da
NCBI Official Full Name
Homo sapiens ring finger protein 34, mRNA
NCBI Official Synonym Full Names
ring finger protein 34
NCBI Official Symbol
RNF34
NCBI Official Synonym Symbols
RFI; RIF; RIFF; hRFI; CARP1; CARP-1
NCBI Protein Information
E3 ubiquitin-protein ligase RNF34
UniProt Protein Name
E3 ubiquitin-protein ligase RNF34
UniProt Gene Name
RNF34
UniProt Synonym Gene Names
hRFI
UniProt Entry Name
RNF34_HUMAN

NCBI Description

The protein encoded by this gene contains a RINF finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein interacts with DNAJA3/hTid-1, which is a DnaJ protein reported to function as a modulator of apoptosis. Overexpression of this gene in Hela cells was shown to confer the resistance to TNF-alpha induced apoptosis, suggesting an anti-apoptotic function of this protein. This protein can be cleaved by caspase-3 during the induction of apoptosis. This protein also targets p53 and phospho-p53 for degradation. Alternatively splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]

Uniprot Description

RNF34: Has E3 ubiquitin-protein ligase activity. Regulates the levels of CASP8 and CASP10 by targeting them for proteasomal degradation. Protects cells against apoptosis induced by TNF. Binds phosphatidylinositol 5-phosphate and phosphatidylinositol 3- phosphate. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Ubiquitin ligase; Ubiquitin conjugating system; Ligase

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; plasma membrane

Molecular Function: p53 binding; protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on RNF34

Similar Products

Product Notes

The RNF34 rnf34 (Catalog #AAA1277442) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcgg gtgccacgtc tatgtgggct tcgtgctgtg ggctgctgaa tgaagtcatg ggaactggag ctgtcagggg ccagcagtca gcatttgcag gagccaccgg tccattcaga tttacaccaa accctgagtt ttccacctac ccaccagcag ctacggaagg gcccaacata gtttgtaaag cctgtgggct ttcattttca gtctttagaa agaagcatgt ttgctgtgac tgcaagaagg atttttgctc cgtttgttca gtcttacaag aaaatctccg tagatgttct acttgtcact tattacaaga gacagcattt cagcgccctc agttaatgcg actgaaggtg aaggacctgc ggcagtatct cattctgaga aatataccca tagatacttg tcgtgagaaa gaagacttgg tggatctagt actgtgccat catggactag gctctgagga cgacatggac acaagcagtc tgaattcttc aaggtcccag acttctagct tttttacacg ttcgtttttt tcaaactata cagccccctc tgctactatg tcttcgtttc agggagagct tatggatgga gaccaaacat ccagatctgg agtgccggca caggtacaaa gtgaaatcac ttcagcaaac acagaagatg atgatgacga cgatgatgag gatgatgatg atgaagaaga aaacgcagag gatcggaacc ccgggctctc caaggagaga gtgagagctt cactgtctga cttgtcaagc cttgatgatg tggaaggaat gagcgtgcgc cagctgaagg aaattctggc tcggaatttt gtcaactatt ctggctgttg tgaaaaatgg gaactggtag agaaagtaaa ccggttatac aaagagaatg aagaaaacca aaagtcctat ggcgagcggc tgcagctgca ggatgaggaa gacgacagcc tgtgtcgcat ctgcatggat gccgtcatcg actgtgtcct actggagtgt gggcacatgg ttacctgcac caagtgcggc aagcgcatga gtgagtgtcc catctgccgg cagtatgtgg tgcgagccgt gcacgtgttc aagtcctga. It is sometimes possible for the material contained within the vial of "RNF34, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.