Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKRIR cdna clone

PRKRIR cDNA Clone

Gene Names
THAP12; DAP4; THAP0; PRKRIR; P52rIPK
Synonyms
PRKRIR; PRKRIR cDNA Clone; PRKRIR cdna clone
Ordering
For Research Use Only!
Sequence
atgggacaactcaaattcaatacgtcggaggaacaccatgctgacatgtatagaagtgacttacccaatcctgacacgctgtcagctgagcttcattgttggagaatcaaatggaaacacagggggaaagatatagagcttccgtccaccatctatgaagccctccacctgcctgacatcaagttttttcctaatgtgtatgcattgctgaaggtcctgtgtattcttcctgtgatgaaggttgagaatgagcggtatgaaaatggacgaaagcgtcttaaagcatatttgaggaacactttgacagaccaaaggtcaagtaacttggctttgcttaacataaattttgatataaaacacgacctggatttaatggtggacacatatattaaactctatacaagtaagtcagagcttcctacagataattccgaaactgtggaaaatacctaa
Sequence Length
453
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,656 Da
NCBI Official Full Name
Homo sapiens protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor), mRNA
NCBI Official Synonym Full Names
THAP domain containing 12
NCBI Official Symbol
THAP12
NCBI Official Synonym Symbols
DAP4; THAP0; PRKRIR; P52rIPK
NCBI Protein Information
52 kDa repressor of the inhibitor of the protein kinase
UniProt Protein Name
52 kDa repressor of the inhibitor of the protein kinase
UniProt Gene Name
THAP12
UniProt Synonym Gene Names
p52rIPK; p58IPK-interacting protein
UniProt Entry Name
P52K_HUMAN

Uniprot Description

PRKRIR: Upstream regulator of interferon-induced serine/threonine protein kinase R (PKR). May block the PKR- inhibitory function of P58IPK, resulting in restoration of kinase activity and suppression of cell growth. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, regulatory subunit; Cell cycle regulation

Chromosomal Location of Human Ortholog: 11q13.5

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: DNA binding; protein binding

Biological Process: negative regulation of cell proliferation; response to stress; signal transduction

Research Articles on PRKRIR

Similar Products

Product Notes

The PRKRIR thap12 (Catalog #AAA1275041) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacaac tcaaattcaa tacgtcggag gaacaccatg ctgacatgta tagaagtgac ttacccaatc ctgacacgct gtcagctgag cttcattgtt ggagaatcaa atggaaacac agggggaaag atatagagct tccgtccacc atctatgaag ccctccacct gcctgacatc aagttttttc ctaatgtgta tgcattgctg aaggtcctgt gtattcttcc tgtgatgaag gttgagaatg agcggtatga aaatggacga aagcgtctta aagcatattt gaggaacact ttgacagacc aaaggtcaag taacttggct ttgcttaaca taaattttga tataaaacac gacctggatt taatggtgga cacatatatt aaactctata caagtaagtc agagcttcct acagataatt ccgaaactgt ggaaaatacc taa. It is sometimes possible for the material contained within the vial of "PRKRIR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.