Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCKIPSD cdna clone

NCKIPSD cDNA Clone

Gene Names
NCKIPSD; DIP; DIP1; ORF1; WISH; VIP54; AF3P21; SPIN90; WASLBP
Synonyms
NCKIPSD; NCKIPSD cDNA Clone; NCKIPSD cdna clone
Ordering
For Research Use Only!
Sequence
atgtaccgcgcgctgtacgcgttccgctcggcggagcccaacgcgctggcgttcgccgcgggcgagaccttcctggtgctagagcgaagcagcgcgcactggtggctggccgcgcgggcgcgcagtggtgagacgggctacgtgccgccagcctacctgcgccgcctgcagggcctggagcaggatgtcctccaggccattgaccgggccatcgaggctgtacacaacacagccatgcgggatggtggcaagtacagcctggaacagcgtggagtcctccagaagctgatccaccaccggaaagagaccctgtcacgcagaggcccttcagcctccagtgttgcagttatgacctcatcaaccagtgaccaccacttggatgctgctgcagccaggcagcccaatggggtgtgtcgagctgggttcgagcggcagcacagcctacccagttctgagcatcttggggcagatggaggcctctaccagatcccaccacagcctcgccgagcagcacccaccacaccgcccccaccagtgaagcgccgagaccgcgaggccctgatggcctctgggagtggtggccacaacaccatgccctccgggggtaactctgtgtccagcggctcctcagtcagcagcacctccctggacacgctctataccagctccagcccatctgaaccaggctccagctgctcacccacacccccacctgtgccccgccgaggcacccacaccaccgtgtcccaagtccagccccctccctccaaggcatcagcacctgaaccccctgcagaagaagaagtggcaactggtacaacctcagcctctgatgacctggaagccctgggtacactgagcctggggaccacagaggagaaggcagcagctgaggcggctgtgcccaggaccattggggccgagctgatggagctggtgcggagaaacactggcctgagccacgaattatgccgggtggccatcggcatcatagtgggtcacatccaggcctcggtgccggccagctcaccagtcatggagcaggtcctcctctcactcgtagagggcaaggacctcagcatggccctgccctcagggcaggtctgccacgaccagcagaggctggaggtgatctttgcagacctggctcgccggaaggacgacgcccagcagcgcagttgggcactatatgaggatgagggtgtcatccgctgctacctagaggagctgctgcatattctgactgatgcagaccctgaagtttgcaagaaaatgtgcaagagaaacgagttcgagtctgtcctggccttggtggcctattaccaaatggaacaccgagcatcactgcggctgctgctcctcaagtgctttggcgccatgtgcagcctggatgcagccatcatctccacgcttgtgtcatccgtgctgcctgtagagctggcgagggacatgcagacagacacgcaggaccaccagaaactctgttactctgccctcatcctggccatggtcttctccatgggagaggcagtgccctatgcacactatgagcacctgggcacgcctttcgcccagttcctactgaacatcgtcgaggatgggctgcccttggacaccacagagcagctgccggacctctgcgtgaacctgcttctggctctcaacctgcacctgccagctgctgaccagaatgtcatcatggctgccctgagcaaacacgccaatgtcaagatcttctccgagaagctgttgttgctcctgaacagaggggatgaccctgtgcgcatcttcaaacatgagccacagccaccacactctgtcctcaagttcctgcaggacgtgtttggcagcccggccacagctgccatcttctaccacacagacatgatggctctcattgacatcactgtgcggcacatcgcagacctgtcaccaggagacaagctgcgcatggagtacctctccctgatgcatgctatagtccgcaccacaccctacctgcagcaccgccaccggctacccgacctgcaggccatactgcgacgcatcctgaatgaggaggagacctcaccccagtgccagatggaccgcatgattgtccgagagatgtgcaaggaattcctggtgctgggggaggctcccagctag
Sequence Length
2148
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,196 Da
NCBI Official Full Name
Homo sapiens NCK interacting protein with SH3 domain, mRNA
NCBI Official Synonym Full Names
NCK interacting protein with SH3 domain
NCBI Official Symbol
NCKIPSD
NCBI Official Synonym Symbols
DIP; DIP1; ORF1; WISH; VIP54; AF3P21; SPIN90; WASLBP
NCBI Protein Information
NCK-interacting protein with SH3 domain
UniProt Protein Name
NCK-interacting protein with SH3 domain
UniProt Gene Name
NCKIPSD
UniProt Synonym Gene Names
AF3P21; SPIN90; VIP54; DIP-1; WISH
UniProt Entry Name
SPN90_HUMAN

NCBI Description

The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

NCKIPSD: Has an important role in stress fiber formation induced by active diaphanous protein homolog 1 (DRF1). Induces microspike formation, in vivo. In vitro, stimulates N-WASP- induced ARP2/3 complex activation in the absence of CDC42. May play an important role in the maintenance of sarcomeres and/or in the assembly of myofibrils into sarcomeres. Implicated in regulation of actin polymerization and cell adhesion. Plays a role in angiogenesis. A chromosomal aberration involving NCKIPSD/AF3p21 is found in therapy-related leukemia. Translocation t(3;11)(p21;q23) with MLL. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis; Oncoprotein

Chromosomal Location of Human Ortholog: 3p21

Cellular Component: cytosol; signalosome

Molecular Function: protein binding

Biological Process: NLS-bearing substrate import into nucleus; signal transduction

Research Articles on NCKIPSD

Similar Products

Product Notes

The NCKIPSD nckipsd (Catalog #AAA1274365) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtaccgcg cgctgtacgc gttccgctcg gcggagccca acgcgctggc gttcgccgcg ggcgagacct tcctggtgct agagcgaagc agcgcgcact ggtggctggc cgcgcgggcg cgcagtggtg agacgggcta cgtgccgcca gcctacctgc gccgcctgca gggcctggag caggatgtcc tccaggccat tgaccgggcc atcgaggctg tacacaacac agccatgcgg gatggtggca agtacagcct ggaacagcgt ggagtcctcc agaagctgat ccaccaccgg aaagagaccc tgtcacgcag aggcccttca gcctccagtg ttgcagttat gacctcatca accagtgacc accacttgga tgctgctgca gccaggcagc ccaatggggt gtgtcgagct gggttcgagc ggcagcacag cctacccagt tctgagcatc ttggggcaga tggaggcctc taccagatcc caccacagcc tcgccgagca gcacccacca caccgccccc accagtgaag cgccgagacc gcgaggccct gatggcctct gggagtggtg gccacaacac catgccctcc gggggtaact ctgtgtccag cggctcctca gtcagcagca cctccctgga cacgctctat accagctcca gcccatctga accaggctcc agctgctcac ccacaccccc acctgtgccc cgccgaggca cccacaccac cgtgtcccaa gtccagcccc ctccctccaa ggcatcagca cctgaacccc ctgcagaaga agaagtggca actggtacaa cctcagcctc tgatgacctg gaagccctgg gtacactgag cctggggacc acagaggaga aggcagcagc tgaggcggct gtgcccagga ccattggggc cgagctgatg gagctggtgc ggagaaacac tggcctgagc cacgaattat gccgggtggc catcggcatc atagtgggtc acatccaggc ctcggtgccg gccagctcac cagtcatgga gcaggtcctc ctctcactcg tagagggcaa ggacctcagc atggccctgc cctcagggca ggtctgccac gaccagcaga ggctggaggt gatctttgca gacctggctc gccggaagga cgacgcccag cagcgcagtt gggcactata tgaggatgag ggtgtcatcc gctgctacct agaggagctg ctgcatattc tgactgatgc agaccctgaa gtttgcaaga aaatgtgcaa gagaaacgag ttcgagtctg tcctggcctt ggtggcctat taccaaatgg aacaccgagc atcactgcgg ctgctgctcc tcaagtgctt tggcgccatg tgcagcctgg atgcagccat catctccacg cttgtgtcat ccgtgctgcc tgtagagctg gcgagggaca tgcagacaga cacgcaggac caccagaaac tctgttactc tgccctcatc ctggccatgg tcttctccat gggagaggca gtgccctatg cacactatga gcacctgggc acgcctttcg cccagttcct actgaacatc gtcgaggatg ggctgccctt ggacaccaca gagcagctgc cggacctctg cgtgaacctg cttctggctc tcaacctgca cctgccagct gctgaccaga atgtcatcat ggctgccctg agcaaacacg ccaatgtcaa gatcttctcc gagaagctgt tgttgctcct gaacagaggg gatgaccctg tgcgcatctt caaacatgag ccacagccac cacactctgt cctcaagttc ctgcaggacg tgtttggcag cccggccaca gctgccatct tctaccacac agacatgatg gctctcattg acatcactgt gcggcacatc gcagacctgt caccaggaga caagctgcgc atggagtacc tctccctgat gcatgctata gtccgcacca caccctacct gcagcaccgc caccggctac ccgacctgca ggccatactg cgacgcatcc tgaatgagga ggagacctca ccccagtgcc agatggaccg catgattgtc cgagagatgt gcaaggaatt cctggtgctg ggggaggctc ccagctag. It is sometimes possible for the material contained within the vial of "NCKIPSD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.