Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ECE2 cdna clone

ECE2 cDNA Clone

Synonyms
ECE2; ECE2 cDNA Clone; ECE2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctctccaggggcaggtagggcgcctccggagttaccggagcggaactgcgggtaccgcgaagtcgagtactgggatcagcgctaccaaggcgcagccgattctgccccctacgattggttcggggacttctcctccttccgtgccctcctagagccggagctgcggcccgaggaccgtatccttgtgctaggttgcgggaacagtgccctgagctacgagctgttcctcggaggcttccctaatgtgaccagtgtggactactcatcagtcgtggtggctgccatgcaggctcgctatgcccatgtgccgcagctgcgctgggagaccatggatgtgcggaagctggacttccccagtgcttcttttgatgtggtgctcgagaagggcacgctggatgccctgctggctggggaacgagatccctggaccgtgtcctctgaaggtgtccacactgtggaccaggtgttgagtgaggtgagccgcgtgcttgtccctggaggccggtttatctcaatgacttctgctgccccccactttcggaccagacactatgcccaagcctattatggctggtccctgaggcatgctacctatggcagcggtttccacttccatctctacctcatgcacaagggcgggaagctcagtgtggcccagctggctctgggggcccaaatcctctcaccccccagacctcccacctcaccttgcttccttcaggactcagatcatgaggacttccttagtgccattcagctctga
Sequence Length
768
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
91,211 Da
NCBI Official Full Name
Homo sapiens endothelin converting enzyme 2, mRNA
NCBI Official Synonym Full Names
endothelin converting enzyme 2
NCBI Official Symbol
ECE2
NCBI Protein Information
endothelin-converting enzyme 2
UniProt Protein Name
Endothelin-converting enzyme 2
UniProt Gene Name
ECE2
UniProt Synonym Gene Names
KIAA0604; ECE-2
UniProt Entry Name
ECE2_HUMAN

NCBI Description

This gene encodes a member of the M13 family, which includes type 2 integral membrane metallopeptidases. The encoded enzyme is a membrane-bound zinc-dependent metalloprotease. The enzyme catalyzes the cleavage of big endothelin to produce the vasoconstrictor endothelin-1, and plays a role in the processing of several neuroendocrine peptides. It may also have methyltransferase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

ECE2: Converts big endothelin-1 to endothelin-1. Also involved in the processing of various neuroendocrine peptides, including neurotensin, angiotensin I, substance P, proenkephalin-derived peptides, and prodynorphin-derived peptides. May limit beta- amyloid peptide accumulation in brain. May also have methyltransferase activity. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; Methyltransferase, protein arginine, predicted; Protease; Vesicle; Membrane protein, integral; EC 3.4.24.71

Chromosomal Location of Human Ortholog: 3q27.1

Cellular Component: cytoplasmic vesicle membrane

Molecular Function: metalloendopeptidase activity; protein binding

Biological Process: brain development; cardioblast differentiation; cell-cell signaling; heart development; peptide hormone processing

Research Articles on ECE2

Similar Products

Product Notes

The ECE2 ece2 (Catalog #AAA1266214) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctctc caggggcagg tagggcgcct ccggagttac cggagcggaa ctgcgggtac cgcgaagtcg agtactggga tcagcgctac caaggcgcag ccgattctgc cccctacgat tggttcgggg acttctcctc cttccgtgcc ctcctagagc cggagctgcg gcccgaggac cgtatccttg tgctaggttg cgggaacagt gccctgagct acgagctgtt cctcggaggc ttccctaatg tgaccagtgt ggactactca tcagtcgtgg tggctgccat gcaggctcgc tatgcccatg tgccgcagct gcgctgggag accatggatg tgcggaagct ggacttcccc agtgcttctt ttgatgtggt gctcgagaag ggcacgctgg atgccctgct ggctggggaa cgagatccct ggaccgtgtc ctctgaaggt gtccacactg tggaccaggt gttgagtgag gtgagccgcg tgcttgtccc tggaggccgg tttatctcaa tgacttctgc tgccccccac tttcggacca gacactatgc ccaagcctat tatggctggt ccctgaggca tgctacctat ggcagcggtt tccacttcca tctctacctc atgcacaagg gcgggaagct cagtgtggcc cagctggctc tgggggccca aatcctctca ccccccagac ctcccacctc accttgcttc cttcaggact cagatcatga ggacttcctt agtgccattc agctctga. It is sometimes possible for the material contained within the vial of "ECE2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.