RAP1GDS1 cdna clone

RAP1GDS1 cDNA Clone

Gene Names

RAP1GDS1; GDS1; SmgGDS

Synonyms

RAP1GDS1; RAP1GDS1 cDNA Clone; RAP1GDS1 cdna clone

Ordering
Cat. Num. AAA1274189 For Research Use Only!

Sequence

atggcagataatctcagtgataccttgaagaagctgaagataacagctgttgacaagactgaggatagtttagaaggatgcttggattgtctgcttcaagccctggctcaaaataatacggaaacaagtgaaaaaatccaagcaagtggaatacttcagctgtttgcaactctgttgactccacagtcttcctgcaaagccaaagtagctaacatcatagcagaagtagccaaaaatgagtttatgcgaattccatgtgtggatgctggattgatttcaccactggtgcagctgctaaatagcaaagaccaggaagtgctgcttcaaacgggcagggctctaggaaacatatgttacgatagccatgagggcagaagtgcagttgaccaagcaggtggtgcacagattgtaattgaccatttaaggtcactgtgcagtataacagatcccgccaatgagaagctcttgactgtcttttgtggcatgctgatgaactatagcaatgagaatgattcgcttcaagctcagcttatcaatatgggtgttattcctaccttagtgaaattactgggcatccactgccaaaatgcagctcttacagaaatgtgtcttgttgcatttggtaatttagcagaacttgagtcaagtaaagaacagtttgccagtacaaacattgctgaagagctagtaaaactcttcaagaaacaaatagaacatgataagagagaaatgatttttgaagttcttgctccattggcagaaaatgatgctattaaactacagctggttgaagcaggcctagtagagtgtctactagagattgttcagcaaaaagtggatagtgacaaagaagatgatattactgagctcaaaactggttcagatctcatggttttattacttcttggagatgaatccatgcagaagttatttgaaggaggaaaaggtagtgtatttcaaagggtactctcttggatcccatcaaataaccaccagctacagcttgctggagcattggcaattgcaaattttgccagaaatgatgcaaattgtattcatatggtagacaatgggattgtagaaaaacttatggatttactggacagacatgtagaagatggaaatgtaacagtacagcatgcagcactaagtgccctcagaaacctggccattccagttataaataaagcaaagatgttatcagctggggtcacagaggcagttttgaaatttcttaaatctgaaatgcctcctgttcagttcaaacttctgggaacattaagaatgttaatagatgcacaagaagctgctgaacaattgggaaagaatgttaagttagtggagcgtttggtggaatggtgtgaagccaaagatcatgctggtgtgatgggggagtcaaacagactgctgtctgcccttatacgacacagtaaatcaaaagatgtaattaaaaccattgtgcagagtggtggcatcaagcatctagttaccatggcaactagtgaacatgtaataatgcagaatgaagctcttgttgctttggcattaatagcagctttagaattgggcactgctgagaaagatctagaaagtgctaaacttgtacagattttacatagactgctagcagatgagagaagtgctcctgaaatcaaatataattccatggtcctgatatgtgctcttatgggatctgaatgtctacacaaggaagtacaggatttggcttttctagatgtcgtatccaaacttcgcagtcatgagaacaaaagtgttgcccagcaggcctctctcacagagcagagacttactgtggaaagctga

Sequence Length

1824

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33871663

NCBI GeneID

5910

Molecular Weight

56,536 Da

NCBI Official Full Name

Homo sapiens RAP1, GTP-GDP dissociation stimulator 1, mRNA

NCBI Official Synonym Full Names

Rap1 GTPase-GDP dissociation stimulator 1

NCBI Official Symbol

RAP1GDS1

NCBI Official Synonym Symbols

GDS1; SmgGDS

NCBI Protein Information

rap1 GTPase-GDP dissociation stimulator 1

UniProt Protein Name

Rap1 GTPase-GDP dissociation stimulator 1

Protein Family

Rap1 GTPase-GDP dissociation stimulator

UniProt Gene Name

RAP1GDS1

UniProt Entry Name

GDS1_HUMAN

NCBI Description

The smg GDP dissociation stimulator (smgGDS) protein is a stimulatory GDP/GTP exchange protein with GTPase activity (Riess et al., 1993 [PubMed 8262526]).[supplied by OMIM, Feb 2010]

Uniprot Description

RAP1GDS1: Stimulates GDP/GTP exchange reaction of a group of small GTP-binding proteins (G proteins) including Rap1a/Rap1b, RhoA, RhoB and KRas, by stimulating the dissociation of GDP from and the subsequent binding of GTP to each small G protein. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs, misc.; GEFs

Chromosomal Location of Human Ortholog: 4q23-q25

Cellular Component: cytosol; endoplasmic reticulum; mitochondrion

Molecular Function: protein binding

Biological Process: elevation of mitochondrial calcium ion concentration; positive regulation of GTPase activity; reduction of endoplasmic reticulum calcium ion concentration; small GTPase mediated signal transduction

Research Articles on RAP1GDS1

1. DiRas1 expression inhibits malignant features of cancers in part by nonproductively binding to SmgGDS and inhibiting the binding of other small GTPases to SmgGDS

Similar Products

Product Notes

The RAP1GDS1 rap1gds1 (Catalog #AAA1274189) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagata atctcagtga taccttgaag aagctgaaga taacagctgt tgacaagact gaggatagtt tagaaggatg cttggattgt ctgcttcaag ccctggctca aaataatacg gaaacaagtg aaaaaatcca agcaagtgga atacttcagc tgtttgcaac tctgttgact ccacagtctt cctgcaaagc caaagtagct aacatcatag cagaagtagc caaaaatgag tttatgcgaa ttccatgtgt ggatgctgga ttgatttcac cactggtgca gctgctaaat agcaaagacc aggaagtgct gcttcaaacg ggcagggctc taggaaacat atgttacgat agccatgagg gcagaagtgc agttgaccaa gcaggtggtg cacagattgt aattgaccat ttaaggtcac tgtgcagtat aacagatccc gccaatgaga agctcttgac tgtcttttgt ggcatgctga tgaactatag caatgagaat gattcgcttc aagctcagct tatcaatatg ggtgttattc ctaccttagt gaaattactg ggcatccact gccaaaatgc agctcttaca gaaatgtgtc ttgttgcatt tggtaattta gcagaacttg agtcaagtaa agaacagttt gccagtacaa acattgctga agagctagta aaactcttca agaaacaaat agaacatgat aagagagaaa tgatttttga agttcttgct ccattggcag aaaatgatgc tattaaacta cagctggttg aagcaggcct agtagagtgt ctactagaga ttgttcagca aaaagtggat agtgacaaag aagatgatat tactgagctc aaaactggtt cagatctcat ggttttatta cttcttggag atgaatccat gcagaagtta tttgaaggag gaaaaggtag tgtatttcaa agggtactct cttggatccc atcaaataac caccagctac agcttgctgg agcattggca attgcaaatt ttgccagaaa tgatgcaaat tgtattcata tggtagacaa tgggattgta gaaaaactta tggatttact ggacagacat gtagaagatg gaaatgtaac agtacagcat gcagcactaa gtgccctcag aaacctggcc attccagtta taaataaagc aaagatgtta tcagctgggg tcacagaggc agttttgaaa tttcttaaat ctgaaatgcc tcctgttcag ttcaaacttc tgggaacatt aagaatgtta atagatgcac aagaagctgc tgaacaattg ggaaagaatg ttaagttagt ggagcgtttg gtggaatggt gtgaagccaa agatcatgct ggtgtgatgg gggagtcaaa cagactgctg tctgccctta tacgacacag taaatcaaaa gatgtaatta aaaccattgt gcagagtggt ggcatcaagc atctagttac catggcaact agtgaacatg taataatgca gaatgaagct cttgttgctt tggcattaat agcagcttta gaattgggca ctgctgagaa agatctagaa agtgctaaac ttgtacagat tttacataga ctgctagcag atgagagaag tgctcctgaa atcaaatata attccatggt cctgatatgt gctcttatgg gatctgaatg tctacacaag gaagtacagg atttggcttt tctagatgtc gtatccaaac ttcgcagtca tgagaacaaa agtgttgccc agcaggcctc tctcacagag cagagactta ctgtggaaag ctga. It is sometimes possible for the material contained within the vial of "RAP1GDS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

RAP1GDS1 cdna clone