ZNRD1 cdna clone

ZNRD1

Cat. Num. AAA200956

• Gene Names: ZNRD1; TEX6; ZR14; HTEX6; Rpa12; hZR14; HTEX-6; TCTEX6; tctex-6
• Synonyms: ZNRD1; HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZR14; ZNRD1 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGTCTGTCATGGACCTCGCCAATACTTGCTCCAGCTTTCAGTCGGACCTGGATTTCTGTTCAGATTGCGGCTCGGTCCTGCCTCTGCCCGGGGCTCAGGATACGGTCACCTGTATTCGCTGTGGCTTCAACATCAACGTTCGGGACTTTGAGGGGAAGGTTGTGAAGACTTCGGTTGTGTTCCACCAACTGGGGACAGCCATGCCTATGTCGGTGGAGGAAGGGCCTGAGTGCCAGGGACCTGTGGTTGACAGGCGCTGCCCTCGATGTGGTCATGAAGGAATGGCATACCACACCAGACAGATGCGTTCAGCCGATGAAGGGCAAACTGTCTTCTACACCTGTACCAACTGCAAGTTCCAGGAGAAGGAAGACTCTTGA; ; Translation Sequence: MSVMDLANTC SSFQSDLDFC SDCGSVLPLP GAQDTVTCIR CGFNINVRDF EGKVVKTSVVFHQLGTAMPM SVEEGPECQG PVVDRRCPRC GHEGMAYHTR QMRSADEGQT VFYTCTNCKFQEKEDS
• Sequence Length: 126

• Species: Human
• Chromosome Location: 6p21.3
• OMIM Reference Number: 607525
• cDNA Size: 381bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for ZNRD1 cdna clone

ZNRD1 is a DNA-directed RNA polymerase I subunit. It contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. ZNRD1 may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants.

Product Categories/Family for ZNRD1 cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 25777707
• NCBI GeneID: 30834
• NCBI Accession #: NP_740753.1
• NCBI GenBank Nucleotide #: NM_170783.3
• UniProt Accession #: Q9P1U0
• NCBI Official Full Name: DNA-directed RNA polymerase I subunit RPA12
• NCBI Official Synonym Full Names: zinc ribbon domain containing 1
• NCBI Official Symbol: ZNRD1
• NCBI Official Synonym Symbols: TEX6; ZR14; HTEX6; Rpa12; hZR14; HTEX-6; TCTEX6; tctex-6
• NCBI Protein Information: DNA-directed RNA polymerase I subunit RPA12
• UniProt Protein Name: DNA-directed RNA polymerase I subunit RPA12
• UniProt Gene Name: ZNRD1
• UniProt Synonym Gene Names: RPA12
• UniProt Entry Name: RPA12_HUMAN

NCBI Description

This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Uniprot Description

ZNRD1: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase I which synthesizes ribosomal RNA precursors. Belongs to the archaeal RpoM/eukaryotic RPA12/RPB9/RPC11 RNA polymerase family.

Protein type: Nucleolus; Transcription initiation complex; Transferase

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: nucleoplasm; DNA-directed RNA polymerase I complex

Molecular Function: nucleic acid binding; zinc ion binding

Biological Process: negative regulation of gene expression, epigenetic; nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; transcription from RNA polymerase I promoter; RNA elongation from RNA polymerase I promoter; gene expression; transcription initiation from RNA polymerase I promoter; termination of RNA polymerase I transcription; regulation of gene expression, epigenetic