ZNF461 cdna clone
ZNF461 cDNA Clone
Gene Names
ZNF461; GIOT1; HZF28; GIOT-1
Synonyms
ZNF461; ZNF461 cDNA Clone; ZNF461 cdna clone
Sequence
atggaagaatttaaaagccatagtcctgagagatcaattttcagcgctatctgggaaggcaactgtcattttgagcaacatcagggacaagaggagggttattttagacaacttatgattaaccatgaaaacatgcccatttttagccaacatactttactcactcaagaattttatgatagagagaaaatctctgaatgtaaaaagtgtagaaaaatcttcagttaccatttattttttagtcaccacaaaagaactcattctaaagaactttctgaatgtaaagaatgcacagaaattgttaatacaccatgcctttttaaacaacagacaattcaaaatggtgacaaatgcaatgagtgtaaagaatgttggaaggcctttgttcattgctcacaacttaaacatctaagaattcataatggtgaaaaacgctatgaatgtaacgaatgtgggaaggcctttaattatggctcagaacttactctacatcaaagaattcacactggtgagaaaccttatgaatgtaaagaatgtgggaaggcctttagacagcgatcacagcttactcaacatcagagacttcatactggtgaaaaaccctatgaatgtaagcaatgtgggaaggcttttattcgtggctttcaacttactgaacacctgcgactccatactggagagaaaccttatgaatgtaaagaatgtggaaagacttttaggcatcgctcacatcttactatacatcagagaattcatactggtgagaaaccctatgaatgtcgggaatgtgggaaggcctttagctatcactcaagcttctcacaccatcagaaaattcattctggcaagaaaccttatgaatgtcatgaatgtgggaaggctttttgtgatggcttacaactaaccctacatcagaggattcatactggtgagaaaccctatgagtgtaaggaatgtgggaagacttttagacagtgttcacacctcaaaagacatcagagaattcatactggtgagaaacctcatgaatgcatgatatgtggtaaggcctttagacttcattcacaccttattcaacatcaaagaattcatactggtgagaaaccctatgaatgtaaggaatgtgggaaggcctttagctatcattcaagcttctcacaccatcagagaattcattctggaaagaaaccttatcaatgcgggaaggcgtttaatcatagattacaacttaacttacatcagactcttcatactggcgagaagccagtcaggtttcctctcctccctccccatcctagtctagcatcatga
Sequence Length
1311
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,516 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 461, mRNA
NCBI Official Synonym Full Names
zinc finger protein 461
NCBI Official Symbol
ZNF461
NCBI Official Synonym Symbols
GIOT1; HZF28; GIOT-1
NCBI Protein Information
zinc finger protein 461
UniProt Protein Name
Zinc finger protein 461
Protein Family
UniProt Gene Name
ZNF461
UniProt Synonym Gene Names
GIOT1; GIOT-1
UniProt Entry Name
ZN461_HUMAN
Uniprot Description
ZNF461: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein; Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 19q13.12
Molecular Function: transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZNF461
Similar Products
Product Notes
The ZNF461 znf461 (Catalog #AAA1266870) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaat ttaaaagcca tagtcctgag agatcaattt tcagcgctat ctgggaaggc aactgtcatt ttgagcaaca tcagggacaa gaggagggtt attttagaca acttatgatt aaccatgaaa acatgcccat ttttagccaa catactttac tcactcaaga attttatgat agagagaaaa tctctgaatg taaaaagtgt agaaaaatct tcagttacca tttatttttt agtcaccaca aaagaactca ttctaaagaa ctttctgaat gtaaagaatg cacagaaatt gttaatacac catgcctttt taaacaacag acaattcaaa atggtgacaa atgcaatgag tgtaaagaat gttggaaggc ctttgttcat tgctcacaac ttaaacatct aagaattcat aatggtgaaa aacgctatga atgtaacgaa tgtgggaagg cctttaatta tggctcagaa cttactctac atcaaagaat tcacactggt gagaaacctt atgaatgtaa agaatgtggg aaggccttta gacagcgatc acagcttact caacatcaga gacttcatac tggtgaaaaa ccctatgaat gtaagcaatg tgggaaggct tttattcgtg gctttcaact tactgaacac ctgcgactcc atactggaga gaaaccttat gaatgtaaag aatgtggaaa gacttttagg catcgctcac atcttactat acatcagaga attcatactg gtgagaaacc ctatgaatgt cgggaatgtg ggaaggcctt tagctatcac tcaagcttct cacaccatca gaaaattcat tctggcaaga aaccttatga atgtcatgaa tgtgggaagg ctttttgtga tggcttacaa ctaaccctac atcagaggat tcatactggt gagaaaccct atgagtgtaa ggaatgtggg aagactttta gacagtgttc acacctcaaa agacatcaga gaattcatac tggtgagaaa cctcatgaat gcatgatatg tggtaaggcc tttagacttc attcacacct tattcaacat caaagaattc atactggtga gaaaccctat gaatgtaagg aatgtgggaa ggcctttagc tatcattcaa gcttctcaca ccatcagaga attcattctg gaaagaaacc ttatcaatgc gggaaggcgt ttaatcatag attacaactt aacttacatc agactcttca tactggcgag aagccagtca ggtttcctct cctccctccc catcctagtc tagcatcatg a. It is sometimes possible for the material contained within the vial of "ZNF461, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
