Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZC3H12A cdna clone

ZC3H12A cDNA Clone

Gene Names
ZC3H12A; MCPIP; MCPIP1; dJ423B22.1
Synonyms
ZC3H12A; ZC3H12A cDNA Clone; ZC3H12A cdna clone
Ordering
For Research Use Only!
Sequence
atgagtggcccctgtggagagaagcctgtcctggaagccagccccaccatgagtctgtgggaatttgaggacagccacagccgtcagggcaccccaaggccgggtcaagagctggccgctgaggaggcctcggccctggaactgcagatgaaggtggacttcttccggaagctgggctattcatccacggagatccacagcgtcctgcagaagctgggcgtccaggcagacaccaacacggtgctgggtgagctggtgaaacacgggacagccaccgagcgggagcgccagacctcaccggacccctgccctcagctccctctagtcccgcggggtggtggcacccctaaggctcccaacctggagcctccactcccagaagaggaaaaggagggcagcgacctgagaccagtggtcatcgatgggagcaacgtggccatgagccatgggaacaaggaggtcttctcctgccggggcatcctgctggcagtgaactggtttctggagcggggccacacagacatcacagtgtttgtgccatcctggaggaaggagcagcctcggcccgacgtgcccatcacagaccagcacatcctgcgggaactggagaagaagaagatcctggtgttcacaccatcacgacgcgtgggtggcaagcgggtggtgtgctatgacgacagattcattgtgaagctggcctacgagtctgacgggatcgtggtttccaacgacacataccgtgacctccaaggcgagcggcaggagtggaagcgcttcatcgaggagcggctgctcatgtactccttcgtcaatgacaagtttatgccccctgatgacccactgggccggcacgggcccagcctggacaacttcctgcgtaagaagccactcactttggagcacaggaagcagccgtgtccctatggaaggaaatgcacctatgggatcaagtgccgattcttccacccagagcggccaagctgcccccagcgctctgtggcagatgagctccgtgccaatgctctcctctcaccccccagagccccaagcaaggacaaaaatggccggcggccttcaccttcatcccagtccagctctctgctaacagagagtgagcagtgcagcctggatgggaagaagctgggggcccaggcatccccagggtcccgccaagagggtctaacacagacctatgccccatcaggcaggagcctcgcacctagcgggggcagtggcagcagctttgggcccacagactggctcccacagacgctggactcactcccgtacgtctcccaggattgcctggactcgggcattggctccctggagagccagatgtcggaactttggggggttcgaggaggaggccctggtgagccgggcccaccccgagccccttacacgggctacagtccctatggatctgagctcccagccaccgcagccttctctgcctttggccgggccatgggtgctggccacttcagtgtccctgccgactacccacccgcgccccctgcctttccacctcgagagtactggtctgaaccatacccactgcccccacccacatcagtccttcaggagcccccagtgcagagcccaggggctggcaggagcccgtggggcagggcagacagcctggccaaggagcaggccagcgtgtatactaagctgtgtggtgtgtttcccccgcacctggtggaggctgtgatggggcgcttcccacagctcctggacccccagcagctggctgccgagatcctctcctacaagtcccagcaccccagtgagtaa
Sequence Length
1800
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,699 Da
NCBI Official Full Name
Homo sapiens zinc finger CCCH-type containing 12A, mRNA
NCBI Official Synonym Full Names
zinc finger CCCH-type containing 12A
NCBI Official Symbol
ZC3H12A
NCBI Official Synonym Symbols
MCPIP; MCPIP1; dJ423B22.1
NCBI Protein Information
bifunctional endoribonuclease and deubiquitinase ZC3H12A
UniProt Protein Name
Bifunctional endoribonuclease and deubiquitinase ZC3H12A
Protein Family
UniProt Gene Name
ZC3H12A
UniProt Synonym Gene Names
Reg1
UniProt Entry Name
ZC12A_HUMAN

NCBI Description

ZC3H12A is an MCP1 (CCL2; MIM 158105)-induced protein that acts as a transcriptional activator and causes cell death of cardiomyocytes, possibly via induction of genes associated with apoptosis.[supplied by OMIM, Mar 2008]

Uniprot Description

MCPIP1: Has RNase activity and selectively degrades specific target mRNA species. Modulates the immune response and inflammation by regulating the decay of specific mRNA molecules. Recognizes the 3'-untranslated region (UTR) of the mRNA for IL6, CALCR and IL12B. Required for normal decay of IL6 mRNA. Triggers apoptosis and promotes angiogenesis in response to the binding of CCL2 to CCR2. Regulates expression of CDH12 and CHD19. Belongs to the ZC3H12 family.

Protein type: EC 3.1.-.-; Hydrolase

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: cytoplasm; cytoskeleton; nucleoplasm; nucleus; plasma membrane; protein complex; rough endoplasmic reticulum

Molecular Function: chromatin binding; DNA binding; endoribonuclease activity; exoribonuclease activity; miRNA binding; mRNA 3'-UTR binding; mRNA binding; protein binding; ribonuclease activity; ribosome binding; RNA binding; ubiquitin-specific protease activity

Biological Process: cellular response to glucose starvation; inhibition of NF-kappaB transcription factor; mRNA catabolic process, endonucleolytic cleavage-dependent decay; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of interleukin-1 beta secretion; negative regulation of interleukin-6 production; negative regulation of macrophage activation; negative regulation of NF-kappaB import into nucleus; negative regulation of nitric oxide biosynthetic process; negative regulation of protein amino acid phosphorylation; negative regulation of tumor necrosis factor production; positive regulation of angiogenesis; positive regulation of autophagy; positive regulation of defense response to virus by host; positive regulation of fat cell differentiation; positive regulation of protein import into nucleus; positive regulation of transcription from RNA polymerase II promoter; protein deubiquitination; protein oligomerization; regulation of gene expression; response to DNA damage stimulus

Research Articles on ZC3H12A

Similar Products

Product Notes

The ZC3H12A zc3h12a (Catalog #AAA1273894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtggcc cctgtggaga gaagcctgtc ctggaagcca gccccaccat gagtctgtgg gaatttgagg acagccacag ccgtcagggc accccaaggc cgggtcaaga gctggccgct gaggaggcct cggccctgga actgcagatg aaggtggact tcttccggaa gctgggctat tcatccacgg agatccacag cgtcctgcag aagctgggcg tccaggcaga caccaacacg gtgctgggtg agctggtgaa acacgggaca gccaccgagc gggagcgcca gacctcaccg gacccctgcc ctcagctccc tctagtcccg cggggtggtg gcacccctaa ggctcccaac ctggagcctc cactcccaga agaggaaaag gagggcagcg acctgagacc agtggtcatc gatgggagca acgtggccat gagccatggg aacaaggagg tcttctcctg ccggggcatc ctgctggcag tgaactggtt tctggagcgg ggccacacag acatcacagt gtttgtgcca tcctggagga aggagcagcc tcggcccgac gtgcccatca cagaccagca catcctgcgg gaactggaga agaagaagat cctggtgttc acaccatcac gacgcgtggg tggcaagcgg gtggtgtgct atgacgacag attcattgtg aagctggcct acgagtctga cgggatcgtg gtttccaacg acacataccg tgacctccaa ggcgagcggc aggagtggaa gcgcttcatc gaggagcggc tgctcatgta ctccttcgtc aatgacaagt ttatgccccc tgatgaccca ctgggccggc acgggcccag cctggacaac ttcctgcgta agaagccact cactttggag cacaggaagc agccgtgtcc ctatggaagg aaatgcacct atgggatcaa gtgccgattc ttccacccag agcggccaag ctgcccccag cgctctgtgg cagatgagct ccgtgccaat gctctcctct caccccccag agccccaagc aaggacaaaa atggccggcg gccttcacct tcatcccagt ccagctctct gctaacagag agtgagcagt gcagcctgga tgggaagaag ctgggggccc aggcatcccc agggtcccgc caagagggtc taacacagac ctatgcccca tcaggcagga gcctcgcacc tagcgggggc agtggcagca gctttgggcc cacagactgg ctcccacaga cgctggactc actcccgtac gtctcccagg attgcctgga ctcgggcatt ggctccctgg agagccagat gtcggaactt tggggggttc gaggaggagg ccctggtgag ccgggcccac cccgagcccc ttacacgggc tacagtccct atggatctga gctcccagcc accgcagcct tctctgcctt tggccgggcc atgggtgctg gccacttcag tgtccctgcc gactacccac ccgcgccccc tgcctttcca cctcgagagt actggtctga accataccca ctgcccccac ccacatcagt ccttcaggag cccccagtgc agagcccagg ggctggcagg agcccgtggg gcagggcaga cagcctggcc aaggagcagg ccagcgtgta tactaagctg tgtggtgtgt ttcccccgca cctggtggag gctgtgatgg ggcgcttccc acagctcctg gacccccagc agctggctgc cgagatcctc tcctacaagt cccagcaccc cagtgagtaa. It is sometimes possible for the material contained within the vial of "ZC3H12A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.