Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBK1 cdna clone

TBK1 cDNA Clone

Gene Names
TBK1; NAK; T2K; FTDALS4
Synonyms
TBK1; TBK1 cDNA Clone; TBK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagagcacttctaatcatctgtggcttttatctgatattttaggccaaggagctactgcaaatgtctttcgtggaagacataagaaaactggtgatttatttgctatcaaagtatttaataacataagcttccttcgtccagtggatgttcaaatgagagaatttgaagtgttgaaaaaactcaatcacaaaaatattgtcaaattatttgctattgaagaggagacaacaacaagacataaagtacttattatggaattttgtccatgtgggagtttatacactgttttagaagaaccttctaatgcctatggactaccagaatctgaattcttaattgttttgcgagatgtggtgggtggaatgaatcatctacgagagaatggtatagtgcaccgtgatatcaagccaggaaatatcatgcgtgttataggggaagatggacagtctgtgtacaaactcacagattttggtgcagctagagaattagaagatgatgagcagtttgtttctctgtatggcacagaagaatatttgcaccctgatatgtatgagagagcagtgctaagaaaagatcatcagaagaaatatggagcaacagttgatctttggagcattggggtaacattttaccatgcagctactggatcactgccatttagaccctttgaagggcctcgtaggaataaagaagtgatgtataaaataattacaggaaagccttctggtgcaatatctggagtacagaaagcagaaaatggaccaattgactggagtggagacatgcctgtttcttgcagtctttctcggggtcttcaggttctacttacccctgttcttgcaaacatccttgaagcagatcaggaaaagtgttggggttttgaccagttttttgcagaaactagtgatatacttcaccgaatggtaattcatgttttttcgctacaacaaatgacagctcataagatttatatacatagctataatactgctactatatttcatgaactggtatataaacaaaccaaaattatttcttcaaatcaagaacttatctacgaagggcgacgcttagtcttagaacctggaaggctggcacaacatttccctaaaactactgaggaaaaccctatatttgtagtaagccgggaacctctggataccataggattaatatatgaaaaaatttccctccctaaagtacatccacgttatgatttagacggggatgctagcatggctaaggcaataacaggggttgtgtgttatgcctgcagaattgccagtaccttactgctttatcaggaattaatgcgaaaggggatacgatggctgattgaattaattaaagatgattacaatgaaactgttcacaaaaagacagaagttgtgatcacattggatttctgtatcagaaacattgaaaaaactgtgaaagtatatgaaaagttgatgaagatcaacctggaagcggcagagttaggtgaaatttcagacatacacaccaaattgttgagactttccagttctcagggaacaatagaaaccagtcttcaggatatcgacagcagattatctccaggtggatcactggcagacgcatgggcacatcaagaaggcactcatccgaaagacagaaatgtagaaaaactacaagtcctgttaaattgcatgacagagatttactatcagttcaaaaaagaccaagcagaacgtagattagcttataatgaagaacaaatccacaaatttgataagcaaaaactgtattaccatgccacaaaagctatgacgcactttacagatgaatgtgttaaaaagtatgaggcatttttgaataagtcagaagaatggataagaaagatgcttcatcttaggaaacagttattatcgctgactaatcagtgttttgatattgaagaagaagtatcaaaatatcaagaatatactaatgagttacaagaaactctgcctcagaaaatgtttacagcttccagtggaatcaaacataccatgaccccaatttatccaagttctaacacattagtagaaatgactcttggtatgaagaaattaaaggaagagatggaaggggtggttaaagaacttgctgaaaataaccacattttagaaaggtttggctctttaaccatggatggtggccttcgcaacgttgactgtctttag
Sequence Length
2190
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
83,642 Da
NCBI Official Full Name
Homo sapiens TANK-binding kinase 1, mRNA
NCBI Official Synonym Full Names
TANK binding kinase 1
NCBI Official Symbol
TBK1
NCBI Official Synonym Symbols
NAK; T2K; FTDALS4
NCBI Protein Information
serine/threonine-protein kinase TBK1
UniProt Protein Name
Serine/threonine-protein kinase TBK1
UniProt Gene Name
TBK1
UniProt Synonym Gene Names
NAK
UniProt Entry Name
TBK1_HUMAN

NCBI Description

The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]

Uniprot Description

TBK1: a protein kinase of the IKK family. Can mediate NFkB activation in response to certain growth factors. Forms a complex with the IKB protein TANK and TRAF2 and release the NFKB inhibition caused by TANK.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; Protein kinase, Other; Other group; IKK family

Chromosomal Location of Human Ortholog: 12q14.1

Cellular Component: cytoplasm; cytosol; endosome membrane

Molecular Function: phosphoprotein binding; protein binding; protein kinase activity; protein serine/threonine kinase activity

Biological Process: I-kappaB kinase/NF-kappaB cascade; inflammatory response; innate immune response; interferon type I production; negative regulation of interferon type I production; peptidyl-serine phosphorylation; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interferon type I production; positive regulation of interferon-alpha production; positive regulation of interferon-beta production; positive regulation of transcription from RNA polymerase II promoter; response to virus

Disease: Frontotemporal Dementia And/or Amyotrophic Lateral Sclerosis 4

Research Articles on TBK1

Similar Products

Product Notes

The TBK1 tbk1 (Catalog #AAA1276893) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagagca cttctaatca tctgtggctt ttatctgata ttttaggcca aggagctact gcaaatgtct ttcgtggaag acataagaaa actggtgatt tatttgctat caaagtattt aataacataa gcttccttcg tccagtggat gttcaaatga gagaatttga agtgttgaaa aaactcaatc acaaaaatat tgtcaaatta tttgctattg aagaggagac aacaacaaga cataaagtac ttattatgga attttgtcca tgtgggagtt tatacactgt tttagaagaa ccttctaatg cctatggact accagaatct gaattcttaa ttgttttgcg agatgtggtg ggtggaatga atcatctacg agagaatggt atagtgcacc gtgatatcaa gccaggaaat atcatgcgtg ttatagggga agatggacag tctgtgtaca aactcacaga ttttggtgca gctagagaat tagaagatga tgagcagttt gtttctctgt atggcacaga agaatatttg caccctgata tgtatgagag agcagtgcta agaaaagatc atcagaagaa atatggagca acagttgatc tttggagcat tggggtaaca ttttaccatg cagctactgg atcactgcca tttagaccct ttgaagggcc tcgtaggaat aaagaagtga tgtataaaat aattacagga aagccttctg gtgcaatatc tggagtacag aaagcagaaa atggaccaat tgactggagt ggagacatgc ctgtttcttg cagtctttct cggggtcttc aggttctact tacccctgtt cttgcaaaca tccttgaagc agatcaggaa aagtgttggg gttttgacca gttttttgca gaaactagtg atatacttca ccgaatggta attcatgttt tttcgctaca acaaatgaca gctcataaga tttatataca tagctataat actgctacta tatttcatga actggtatat aaacaaacca aaattatttc ttcaaatcaa gaacttatct acgaagggcg acgcttagtc ttagaacctg gaaggctggc acaacatttc cctaaaacta ctgaggaaaa ccctatattt gtagtaagcc gggaacctct ggataccata ggattaatat atgaaaaaat ttccctccct aaagtacatc cacgttatga tttagacggg gatgctagca tggctaaggc aataacaggg gttgtgtgtt atgcctgcag aattgccagt accttactgc tttatcagga attaatgcga aaggggatac gatggctgat tgaattaatt aaagatgatt acaatgaaac tgttcacaaa aagacagaag ttgtgatcac attggatttc tgtatcagaa acattgaaaa aactgtgaaa gtatatgaaa agttgatgaa gatcaacctg gaagcggcag agttaggtga aatttcagac atacacacca aattgttgag actttccagt tctcagggaa caatagaaac cagtcttcag gatatcgaca gcagattatc tccaggtgga tcactggcag acgcatgggc acatcaagaa ggcactcatc cgaaagacag aaatgtagaa aaactacaag tcctgttaaa ttgcatgaca gagatttact atcagttcaa aaaagaccaa gcagaacgta gattagctta taatgaagaa caaatccaca aatttgataa gcaaaaactg tattaccatg ccacaaaagc tatgacgcac tttacagatg aatgtgttaa aaagtatgag gcatttttga ataagtcaga agaatggata agaaagatgc ttcatcttag gaaacagtta ttatcgctga ctaatcagtg ttttgatatt gaagaagaag tatcaaaata tcaagaatat actaatgagt tacaagaaac tctgcctcag aaaatgttta cagcttccag tggaatcaaa cataccatga ccccaattta tccaagttct aacacattag tagaaatgac tcttggtatg aagaaattaa aggaagagat ggaaggggtg gttaaagaac ttgctgaaaa taaccacatt ttagaaaggt ttggctcttt aaccatggat ggtggccttc gcaacgttga ctgtctttag. It is sometimes possible for the material contained within the vial of "TBK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.