Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STEAP1 cdna clone

STEAP1 cDNA Clone

Gene Names
STEAP1; STEAP; PRSS24
Synonyms
STEAP1; STEAP1 cDNA Clone; STEAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaagcagaaaagacatcacaaaccaagaagaactttggaaaatgaagcctaggagaaatttagaagaagacgattatttgcataaggacacgggagagaccagcatgctaaaaagacctgtgcttttgcatttgcaccaaacagcccatgctgatgaatttgactgcccttcagaacttcagcacacacaggaactctttccacagtggcacttgccaattaaaatagctgctattatagcatctctgacttttctttacactcttctgagggaagtaattcaccctttagcaacttcccatcaacaatatttttataaaattccaatcctggtcatcaacaaagtcttgccaatggtttccatcactctcttggcattggtttacctgccaggtgtgatagcagcaattgtccaacttcataatggaaccaagtataagaagtttccacattggttggataagtggatgttaacaagaaagcagtttgggcttctcagtttcttttttgctgtactgcatgcaatttatagtctgtcttacccaatgaggcgatcctacagatacaagttgctaaactgggcatatcaacaggtccaacaaaataaagaagatgcctggattgagcatgatgtttggagaatggagatttatgtgtctctgggaattgtgggattggcaatactggctctgttggctgtgacatctattccatctgtgagtgactctttgacatggagagaatttcactatattcagagcaagctaggaattgtttcccttctactgggcacaatacacgcattgatttttgcctggaataagtggatagatataaaacaatttgtatggtatacacctccaacttttatgatagctgttttccttccaattgttgtcctgatatttaaaagcatactattcctgccatgcttgaggaagaagatactgaagattagacatggttgggaagacgtcaccaaaattaacaaaactgagatatgttcccagttgtag
Sequence Length
1020
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,851 Da
NCBI Official Full Name
Homo sapiens six transmembrane epithelial antigen of the prostate 1, mRNA
NCBI Official Synonym Full Names
STEAP family member 1
NCBI Official Symbol
STEAP1
NCBI Official Synonym Symbols
STEAP; PRSS24
NCBI Protein Information
metalloreductase STEAP1
UniProt Protein Name
Metalloreductase STEAP1
Protein Family
UniProt Gene Name
STEAP1
UniProt Synonym Gene Names
PRSS24; STEAP
UniProt Entry Name
STEA1_HUMAN

NCBI Description

This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]

Uniprot Description

STEAP1: Metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+). Uses NAD(+) as acceptor. Belongs to the STEAP family.

Protein type: Cell adhesion; Membrane protein, multi-pass; Membrane protein, integral; Oxidoreductase; EC 1.16.1.-

Chromosomal Location of Human Ortholog: 7q21

Cellular Component: endosome; integral to plasma membrane; intercellular junction; membrane; plasma membrane

Molecular Function: channel activity; cupric reductase activity; transporter activity

Biological Process: copper ion import

Research Articles on STEAP1

Similar Products

Product Notes

The STEAP1 steap1 (Catalog #AAA1272316) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaagca gaaaagacat cacaaaccaa gaagaacttt ggaaaatgaa gcctaggaga aatttagaag aagacgatta tttgcataag gacacgggag agaccagcat gctaaaaaga cctgtgcttt tgcatttgca ccaaacagcc catgctgatg aatttgactg cccttcagaa cttcagcaca cacaggaact ctttccacag tggcacttgc caattaaaat agctgctatt atagcatctc tgacttttct ttacactctt ctgagggaag taattcaccc tttagcaact tcccatcaac aatattttta taaaattcca atcctggtca tcaacaaagt cttgccaatg gtttccatca ctctcttggc attggtttac ctgccaggtg tgatagcagc aattgtccaa cttcataatg gaaccaagta taagaagttt ccacattggt tggataagtg gatgttaaca agaaagcagt ttgggcttct cagtttcttt tttgctgtac tgcatgcaat ttatagtctg tcttacccaa tgaggcgatc ctacagatac aagttgctaa actgggcata tcaacaggtc caacaaaata aagaagatgc ctggattgag catgatgttt ggagaatgga gatttatgtg tctctgggaa ttgtgggatt ggcaatactg gctctgttgg ctgtgacatc tattccatct gtgagtgact ctttgacatg gagagaattt cactatattc agagcaagct aggaattgtt tcccttctac tgggcacaat acacgcattg atttttgcct ggaataagtg gatagatata aaacaatttg tatggtatac acctccaact tttatgatag ctgttttcct tccaattgtt gtcctgatat ttaaaagcat actattcctg ccatgcttga ggaagaagat actgaagatt agacatggtt gggaagacgt caccaaaatt aacaaaactg agatatgttc ccagttgtag. It is sometimes possible for the material contained within the vial of "STEAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.