Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNX9 cdna clone

SNX9 cDNA Clone

Gene Names
SNX9; SDP1; WISP; SH3PX1; SH3PXD3A
Synonyms
SNX9; SNX9 cDNA Clone; SNX9 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaccaaggctcgggttatgtatgattttgctgctgaacctggaaataatgaactgacggttaatgaaggagaaatcatcacaatcacaaatccggatgtaggtggaggatggctggaaggaagaaacatcaaaggagaacgagggctggttcccacagactacgttgaaattttacccagtgatggaaaagatcaattttcttgtggaaattcagtggctgaccaagccttccttgattctctctcagccagcacagctcacgccagttcgtcggctgccagcaacaatcaccaggttggcagtggcaatgacccctggtcagcctggagtgcctccaaatctgggaactgggaaagctcagaaggctggggggcccagccagagggggctggagcccaaagaaacacaaacactcccaacaactgggacactgccttcggccacccccaggcctaccaaggaccagcaactggtgatgatgatgactgggatgaagactgggatgggcccaaatcctcttcctactttaaggattcagagtcagctgatgcaggcggcgctcagcgaggaaacagtcgtgctagttcctcatccatgaaaattccccttaacaaatttcctggatttgcgaaacctggcacggaacagtatttgttggccaaacaactagcaaaacccaaagagaaaattcccatcattgttggagattatggcccaatgtgggtttatcctacctctacttttgactgtgtggtagcagatcccaggaaaggctccaaaatgtatggtctaaagagctacatcgaatatcagctaacacctactaacactaatcgatctgtaaaccacaggtataagcactttgactggttatatgagcgtctcctggttaagtttgggtcagccattccaatcccttctcttccagacaaacaagtcacaggccgctttgaagaggaatttatcaaaatgcgcatggagagacttcaggcctggatgaccaggatgtgtcgccatccagtaatctcagaaagtgaagttttccagcagttcctaaatttccgagatgagaaggaatggaaaactggaaagaggaaggccgagagagatgagctggcgggagtcatgatattttccaccatggaaccagaggcacctgacttggacttagtagaaatagagcagaagtgcgaggctgtggggaagttcaccaaggccatggatgacggcgtgaaggagctgctgacggtggggcaggagcactggaagcgctgcacgggcccattacccaaggaatatcagaagataggaaaggccttgcagagtttggccacagtgttcagttccagtggctatcaaggtgaaacagatctcaatgatgcaataacagaagcaggaaagacttatgaagaaattgccagtctcgtggcagaacagccaaagaaagatctccatttcctgatggaatgtaatcacgagtataaaggttttcttggctgcttccctgacatcattggcactcacaagggagcaatagaaaaagtgaaagaaagtgacaaactagttgcaacaagtaaaatcaccctacaagacaaacagaacatggtgaagagagtcagcatcatgtcttacgcgttgcaagctgagatgaatcactttcacagtaaccggatctatgattacaacagtgtcatccgcctgtacctggagcagcaagtgcaattttacgaaacgattgcagaaaagctgaggcaggccctcagccgctttccagtgatgtag
Sequence Length
1788
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,592 Da
NCBI Official Full Name
Homo sapiens sorting nexin 9, mRNA
NCBI Official Synonym Full Names
sorting nexin 9
NCBI Official Symbol
SNX9
NCBI Official Synonym Symbols
SDP1; WISP; SH3PX1; SH3PXD3A
NCBI Protein Information
sorting nexin-9
UniProt Protein Name
Sorting nexin-9
Protein Family
UniProt Gene Name
SNX9
UniProt Synonym Gene Names
SH3PX1; SH3PXD3A; Protein SDP1
UniProt Entry Name
SNX9_HUMAN

NCBI Description

This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Uniprot Description

SNX9: May be involved in several stages of intracellular trafficking. Plays a role in endocytosis via clathrin-coated pits, but also clathrin-independent, actin-dependent fluid-phase endocytosis. Plays a role in macropinocytosis. Promotes internalization of TNFR. Promotes degradation of EGFR after EGF signaling. Stimulates the GTPase activity of DNM1. Promotes DNM1 oligomerization. Promotes activation of the Arp2/3 complex by WASL, and thereby plays a role in the reorganization of the F- actin cytoskeleton. Binds to membranes enriched in phosphatidylinositol 4,5-bisphosphate and promotes membrane tubulation. Has lower affinity for membranes enriched in phosphatidylinositol 3-phosphate. Belongs to the sorting nexin family.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 6q25.3

Cellular Component: cell-cell adherens junction; clathrin-coated vesicle; cytoplasm; cytoplasmic membrane-bound vesicle; cytoplasmic vesicle membrane; endosome; extrinsic to internal side of plasma membrane; plasma membrane; trans-Golgi network

Molecular Function: phosphatidylinositol binding; phosphoinositide binding; protein binding; protein homodimerization activity; ubiquitin protein ligase binding

Biological Process: cytokinesis after mitosis; endocytosis; endosome transport; intracellular protein transport; positive regulation of GTPase activity; positive regulation of membrane protein ectodomain proteolysis; positive regulation of protein kinase activity; positive regulation of protein oligomerization; receptor-mediated endocytosis; vesicle organization and biogenesis

Research Articles on SNX9

Similar Products

Product Notes

The SNX9 snx9 (Catalog #AAA1278939) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacca aggctcgggt tatgtatgat tttgctgctg aacctggaaa taatgaactg acggttaatg aaggagaaat catcacaatc acaaatccgg atgtaggtgg aggatggctg gaaggaagaa acatcaaagg agaacgaggg ctggttccca cagactacgt tgaaatttta cccagtgatg gaaaagatca attttcttgt ggaaattcag tggctgacca agccttcctt gattctctct cagccagcac agctcacgcc agttcgtcgg ctgccagcaa caatcaccag gttggcagtg gcaatgaccc ctggtcagcc tggagtgcct ccaaatctgg gaactgggaa agctcagaag gctggggggc ccagccagag ggggctggag cccaaagaaa cacaaacact cccaacaact gggacactgc cttcggccac ccccaggcct accaaggacc agcaactggt gatgatgatg actgggatga agactgggat gggcccaaat cctcttccta ctttaaggat tcagagtcag ctgatgcagg cggcgctcag cgaggaaaca gtcgtgctag ttcctcatcc atgaaaattc cccttaacaa atttcctgga tttgcgaaac ctggcacgga acagtatttg ttggccaaac aactagcaaa acccaaagag aaaattccca tcattgttgg agattatggc ccaatgtggg tttatcctac ctctactttt gactgtgtgg tagcagatcc caggaaaggc tccaaaatgt atggtctaaa gagctacatc gaatatcagc taacacctac taacactaat cgatctgtaa accacaggta taagcacttt gactggttat atgagcgtct cctggttaag tttgggtcag ccattccaat cccttctctt ccagacaaac aagtcacagg ccgctttgaa gaggaattta tcaaaatgcg catggagaga cttcaggcct ggatgaccag gatgtgtcgc catccagtaa tctcagaaag tgaagttttc cagcagttcc taaatttccg agatgagaag gaatggaaaa ctggaaagag gaaggccgag agagatgagc tggcgggagt catgatattt tccaccatgg aaccagaggc acctgacttg gacttagtag aaatagagca gaagtgcgag gctgtgggga agttcaccaa ggccatggat gacggcgtga aggagctgct gacggtgggg caggagcact ggaagcgctg cacgggccca ttacccaagg aatatcagaa gataggaaag gccttgcaga gtttggccac agtgttcagt tccagtggct atcaaggtga aacagatctc aatgatgcaa taacagaagc aggaaagact tatgaagaaa ttgccagtct cgtggcagaa cagccaaaga aagatctcca tttcctgatg gaatgtaatc acgagtataa aggttttctt ggctgcttcc ctgacatcat tggcactcac aagggagcaa tagaaaaagt gaaagaaagt gacaaactag ttgcaacaag taaaatcacc ctacaagaca aacagaacat ggtgaagaga gtcagcatca tgtcttacgc gttgcaagct gagatgaatc actttcacag taaccggatc tatgattaca acagtgtcat ccgcctgtac ctggagcagc aagtgcaatt ttacgaaacg attgcagaaa agctgaggca ggccctcagc cgctttccag tgatgtag. It is sometimes possible for the material contained within the vial of "SNX9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.