Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC16B cdna clone

SEC16B cDNA Clone

Gene Names
SEC16B; RGPR; LZTR2; SEC16S; PGPR-p117
Synonyms
SEC16B; SEC16B cDNA Clone; SEC16B cdna clone
Ordering
For Research Use Only!
Sequence
atggaactttgggctccccagaggctgccccagacacgagggaaggccacagcaccctcaaaggatccagaccgagggtttcggagagatggacatcatcggcctgtccctcactcttggcacaatggagagaggtttcaccaatggcaagacaaccgtgggagcccccagccacagcaggagcccagggcagaccatcagcagcagccccattatgcatccaggccaggggactggcatcagcctgtgtctggagttgactattacgaaggtggttatcgcaatcagttgtattcaaggccaggttatgagaattcatatcagagctatcagtctcccacaatgagggaggaatatgcttatggaagttattactatcatggacacccacagtggctgcaggaagaaagagtgccaaggcaacggagtccttatatctggcacgaagattaccgagagcaaaagtaccttgatgaacatcattatgaaaaccagcacagtccatttggaacaaatagtgagacccacttccaatctaacagtaggaacccttgtaaagacagccctgcttccaactctggacaggagtggccgggggagctgtttccagggagcctgcttgctgaggcccagaaaaataagccgtcattggctagtgagtccaaccttctccagcagcgtgagtctggtctcagctccagcagctatgagctcagtcagtacatcagagatgccccggagcgggatgatcccccagcttcagcagcttggagtccagttcaggctgaagatgtctcctcagctggtcccaaagcacccatgaagttctacatccctcatgttcctgtgagtttcgggccaggaggtcagctggtgcgtgtaggtcccagctctcccactgacgggcaagcagcccttgttgaattgcacagcatggaggttattcttaatgattccgaagagcaagaggagatgagaagtttctcaggacccttgattagggaagatgtacataaggtggatattatgacgttttgccagcagaaagcagctcagagctgcaaatctgagacactggggagcagagactcagctctactgtggcagctcttggttctcctttgtcgccagaatgggtccatggtggggtctgacatcgctgagctgctaatgcaagactgcaagaagctggagaagtacaagcggcagccccctgtggccaacctcatcaacctgaccgatgaggactggccagtgctgagctctgggaccccgaacctgctcacgggagagatcccccccagtgtggagacacctgcgcagatcgtggagaaattcactaggctgctctactatggaaggaagaaggaagccttggagtgggccatgaagaaccacttgtggggccatgctttgttcctgtccagcaagatggacccacagacctacagctgggtcatgagtggcttcaccagcacgctggcgctcaatgacccactgcagaccctcttccagctcatgtcggggaggattccacaggcagccacgtgttgtggagaaaagcagtggggagactggaggcctcacttggctgtgattctgtcgaatcaggctggggacccagagctgtatcagcgtgcgattgttgccattggggacaccctggctgggaaggggcttgtggaggcagctcacttctgctatctcatggctcacgtgccctttggccactacaccgtgaagacagaccatctggtcttgctgggcagcagccacaggtatgcgacctgggagaaaggaaacagtaaggacattttccaagggactgttttagcccttgttgggttttatggatccagttttcattttctcatgtga
Sequence Length
1878
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,124 Da
NCBI Official Full Name
Homo sapiens SEC16 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SEC16 homolog B, endoplasmic reticulum export factor
NCBI Official Symbol
SEC16B
NCBI Official Synonym Symbols
RGPR; LZTR2; SEC16S; PGPR-p117
NCBI Protein Information
protein transport protein Sec16B
UniProt Protein Name
Protein transport protein Sec16B
Protein Family
UniProt Gene Name
SEC16B
UniProt Synonym Gene Names
KIAA1928; LZTR2; RGPR; SEC16S; RGPR-p117
UniProt Entry Name
SC16B_HUMAN

NCBI Description

SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]).[supplied by OMIM, Jun 2009]

Uniprot Description

SEC16B: Required for secretory cargo traffic from the endoplasmic reticulum to the Golgi apparatus and for normal transitional endoplasmic reticulum (tER) organization. Belongs to the SEC16 family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1q25.2

Cellular Component: cytosol; intracellular membrane-bound organelle

Biological Process: COPII coating of Golgi vesicle; endoplasmic reticulum organization and biogenesis; peroxisome fission; peroxisome organization and biogenesis

Research Articles on SEC16B

Similar Products

Product Notes

The SEC16B sec16b (Catalog #AAA1277943) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacttt gggctcccca gaggctgccc cagacacgag ggaaggccac agcaccctca aaggatccag accgagggtt tcggagagat ggacatcatc ggcctgtccc tcactcttgg cacaatggag agaggtttca ccaatggcaa gacaaccgtg ggagccccca gccacagcag gagcccaggg cagaccatca gcagcagccc cattatgcat ccaggccagg ggactggcat cagcctgtgt ctggagttga ctattacgaa ggtggttatc gcaatcagtt gtattcaagg ccaggttatg agaattcata tcagagctat cagtctccca caatgaggga ggaatatgct tatggaagtt attactatca tggacaccca cagtggctgc aggaagaaag agtgccaagg caacggagtc cttatatctg gcacgaagat taccgagagc aaaagtacct tgatgaacat cattatgaaa accagcacag tccatttgga acaaatagtg agacccactt ccaatctaac agtaggaacc cttgtaaaga cagccctgct tccaactctg gacaggagtg gccgggggag ctgtttccag ggagcctgct tgctgaggcc cagaaaaata agccgtcatt ggctagtgag tccaaccttc tccagcagcg tgagtctggt ctcagctcca gcagctatga gctcagtcag tacatcagag atgccccgga gcgggatgat cccccagctt cagcagcttg gagtccagtt caggctgaag atgtctcctc agctggtccc aaagcaccca tgaagttcta catccctcat gttcctgtga gtttcgggcc aggaggtcag ctggtgcgtg taggtcccag ctctcccact gacgggcaag cagcccttgt tgaattgcac agcatggagg ttattcttaa tgattccgaa gagcaagagg agatgagaag tttctcagga cccttgatta gggaagatgt acataaggtg gatattatga cgttttgcca gcagaaagca gctcagagct gcaaatctga gacactgggg agcagagact cagctctact gtggcagctc ttggttctcc tttgtcgcca gaatgggtcc atggtggggt ctgacatcgc tgagctgcta atgcaagact gcaagaagct ggagaagtac aagcggcagc cccctgtggc caacctcatc aacctgaccg atgaggactg gccagtgctg agctctggga ccccgaacct gctcacggga gagatccccc ccagtgtgga gacacctgcg cagatcgtgg agaaattcac taggctgctc tactatggaa ggaagaagga agccttggag tgggccatga agaaccactt gtggggccat gctttgttcc tgtccagcaa gatggaccca cagacctaca gctgggtcat gagtggcttc accagcacgc tggcgctcaa tgacccactg cagaccctct tccagctcat gtcggggagg attccacagg cagccacgtg ttgtggagaa aagcagtggg gagactggag gcctcacttg gctgtgattc tgtcgaatca ggctggggac ccagagctgt atcagcgtgc gattgttgcc attggggaca ccctggctgg gaaggggctt gtggaggcag ctcacttctg ctatctcatg gctcacgtgc cctttggcca ctacaccgtg aagacagacc atctggtctt gctgggcagc agccacaggt atgcgacctg ggagaaagga aacagtaagg acattttcca agggactgtt ttagcccttg ttgggtttta tggatccagt tttcattttc tcatgtga. It is sometimes possible for the material contained within the vial of "SEC16B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.