RNF185 cdna clone
RNF185 cDNA Clone
Synonyms
RNF185; RNF185 cDNA Clone; RNF185 cdna clone
Sequence
atggcaagcaaggggccctcggcctctgcatctcctgagaactccagtgcaggggggcccagtgggagcagcaatggcgctggcgagagcggagggcaggacagcactttcgagtgcaacatctgcttggacacagccaaggatgccgtcatcagcctgtgtggccacctcttctgttggccgtgtttacatcagtggttggagaccagacctaacagacaggtgtgtcctgtttgcaaagctggcatcagccgagacaaggtcatccccctctatggaaggggcagcactgggcaacaggaccccagagagaagacccctcctcgtcctcaaggacagaggccagagccggagaatagagggggatttcaaggatttggatttggagatggtggcttccagatgtcttttggaattggggcatttccctttgggatatttgccacagcatttaatataaatgatgggcggcctcctccagctgtccctgggacaccccagtatgtggacgagcagttcctgtcacgcctcttcctatttgtggccctggtgatcatgttctggctcctgattgcctaa
Sequence Length
579
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
14,139 Da
NCBI Official Full Name
Homo sapiens ring finger protein 185, mRNA
NCBI Official Synonym Full Names
ring finger protein 185
NCBI Official Symbol
RNF185
NCBI Protein Information
E3 ubiquitin-protein ligase RNF185
UniProt Protein Name
E3 ubiquitin-protein ligase RNF185
Protein Family
UniProt Gene Name
RNF185
UniProt Entry Name
RN185_HUMAN
Uniprot Description
RNF185: Mitochondrial E3 ubiquitin-protein ligase that regulates selective mitochondrial autophagy by mediating 'Lys-63'-linked polyubiquitination of BNIP1. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; EC 6.3.2.-; Ubiquitin ligase; Ubiquitin conjugating system; Ligase; Membrane protein, integral
Chromosomal Location of Human Ortholog: 22q12.2
Cellular Component: endoplasmic reticulum
Molecular Function: protein binding
Biological Process: ER-associated protein catabolic process; protein autoubiquitination
Research Articles on RNF185
Similar Products
Product Notes
The RNF185 rnf185 (Catalog #AAA1273691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaagca aggggccctc ggcctctgca tctcctgaga actccagtgc aggggggccc agtgggagca gcaatggcgc tggcgagagc ggagggcagg acagcacttt cgagtgcaac atctgcttgg acacagccaa ggatgccgtc atcagcctgt gtggccacct cttctgttgg ccgtgtttac atcagtggtt ggagaccaga cctaacagac aggtgtgtcc tgtttgcaaa gctggcatca gccgagacaa ggtcatcccc ctctatggaa ggggcagcac tgggcaacag gaccccagag agaagacccc tcctcgtcct caaggacaga ggccagagcc ggagaataga gggggatttc aaggatttgg atttggagat ggtggcttcc agatgtcttt tggaattggg gcatttccct ttgggatatt tgccacagca tttaatataa atgatgggcg gcctcctcca gctgtccctg ggacacccca gtatgtggac gagcagttcc tgtcacgcct cttcctattt gtggccctgg tgatcatgtt ctggctcctg attgcctaa. It is sometimes possible for the material contained within the vial of "RNF185, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
