Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RCN3 cdna clone

RCN3 cDNA Clone

Gene Names
RCN3; RLP49
Synonyms
RCN3; RCN3 cDNA Clone; RCN3 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgtggcgaccatcagttctgctgcttctgttgctactgaggcacggggcccaggggaagccatccccagacgcaggccctcatggccaggggagggtgcaccaggcggcccccctgagcgacgctccccatgatgacgcccacgggaacttccagtacgaccatgaggctttcctgggacgggaagtggccaaggaattcgaccaactcaccccagaggaaagccaggcccgtctggggcggatcgtggaccgcatggaccgcgcgggggacggcgacggctgggtgtcgctggccgagcttcgcgcgtggatcgcgcacacgcagcagcggcacatacgggactcggtgagcgcggcctgggacacgtacgacacggaccgcgacgggcgtgtgggttgggaggagctgcgcaacgccacctatggccactacgcgcccggtgaagaatttcatgacgtggaggatgcagagacctacaaaaagatgctggctcgggacgagcggcgtttccgggtggccgaccaggatggggactcgatggccactcgagaggagctgacagccttcctgcaccccgaggagttccctcacatgcgggacatcgtgattgctgaaaccctggaggacctggacagaaacaaagatggctatgtccaggtggaggagtacatcgcggatctgtactcagccgagcctggggaggaggagccggcgtgggtgcagacggagaggcagcagttccgggacttccgggatctgaacaaggatgggcacctggatgggagtgaggtgggccactgggtgctgccccctgcccaggaccagcccctggtggaagccaaccacctgctgcacgagagcgacacggacaaggatgggcggctgagcaaagcggaaatcctgggtaattggaacatgtttgtgggcagtcaggccaccaactatggcgaggacctgacccggcaccacgatgagctgtga
Sequence Length
987
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,493 Da
NCBI Official Full Name
Homo sapiens reticulocalbin 3, EF-hand calcium binding domain, mRNA
NCBI Official Synonym Full Names
reticulocalbin 3
NCBI Official Symbol
RCN3
NCBI Official Synonym Symbols
RLP49
NCBI Protein Information
reticulocalbin-3
UniProt Protein Name
Reticulocalbin-3
Protein Family
UniProt Gene Name
RCN3
UniProt Entry Name
RCN3_HUMAN

Uniprot Description

RCN3: Belongs to the CREC family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 19q13.33

Molecular Function: protein binding

Research Articles on RCN3

Similar Products

Product Notes

The RCN3 rcn3 (Catalog #AAA1276101) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtggc gaccatcagt tctgctgctt ctgttgctac tgaggcacgg ggcccagggg aagccatccc cagacgcagg ccctcatggc caggggaggg tgcaccaggc ggcccccctg agcgacgctc cccatgatga cgcccacggg aacttccagt acgaccatga ggctttcctg ggacgggaag tggccaagga attcgaccaa ctcaccccag aggaaagcca ggcccgtctg gggcggatcg tggaccgcat ggaccgcgcg ggggacggcg acggctgggt gtcgctggcc gagcttcgcg cgtggatcgc gcacacgcag cagcggcaca tacgggactc ggtgagcgcg gcctgggaca cgtacgacac ggaccgcgac gggcgtgtgg gttgggagga gctgcgcaac gccacctatg gccactacgc gcccggtgaa gaatttcatg acgtggagga tgcagagacc tacaaaaaga tgctggctcg ggacgagcgg cgtttccggg tggccgacca ggatggggac tcgatggcca ctcgagagga gctgacagcc ttcctgcacc ccgaggagtt ccctcacatg cgggacatcg tgattgctga aaccctggag gacctggaca gaaacaaaga tggctatgtc caggtggagg agtacatcgc ggatctgtac tcagccgagc ctggggagga ggagccggcg tgggtgcaga cggagaggca gcagttccgg gacttccggg atctgaacaa ggatgggcac ctggatggga gtgaggtggg ccactgggtg ctgccccctg cccaggacca gcccctggtg gaagccaacc acctgctgca cgagagcgac acggacaagg atgggcggct gagcaaagcg gaaatcctgg gtaattggaa catgtttgtg ggcagtcagg ccaccaacta tggcgaggac ctgacccggc accacgatga gctgtga. It is sometimes possible for the material contained within the vial of "RCN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.