Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPLA cdna clone

PTPLA cDNA Clone

Gene Names
HACD1; CAP; PTPLA
Synonyms
PTPLA; PTPLA cDNA Clone; PTPLA cdna clone
Ordering
For Research Use Only!
Sequence
atggggcgcctgacggaagcggcggcagcgggcagcggctctcgggctgcaggctgggcagggtcccctcccacgctcctgccgctgtctcccacgtcccccaggtgcgcggccaccatggcgtccagcgacgaggacggcaccaacggcggcgcctcggaggccggcgaggaccgggaggctcccggcaagcggaggcgcctggggttcttggccaccgcctggctcaccttctacgacatcgccatgaccgcggggtggttggttctagctattgccatggtacgtttttatatggaaaaaggaacacacagaggtttatataaaagtattcagaagacacttaaatttttccagacatttgccttgcttgagatagttcactgtttaattggaattgtacctacttctgtgattgtgactggggtccaagtgagttcaagaatctttatggtgtggctcattactcacagtataaaaccaatccagaatgaagagagtgtggtgctttttctggtcgcgtggactgtgacagagatcactcgctattccttctacacattcagccttcttgaccacttgccatacttcattaaatgggccagatataatttttttatcatcttatatcctgttggagttgctggtgaacttcttacaatatacgctgccttgccgcatgtgaagaaaacaggaatgttttcaataagacttcctaacaaatacaatgtctcttttgactactattattttcttcttataaccatggcatcatatatacctttgtttccacaactctattttcatatgttacgtcaaagaagaaaggtgcttcatggagaggtgattgtagaaaaggatgattaa
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,920 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A, mRNA
NCBI Official Synonym Full Names
3-hydroxyacyl-CoA dehydratase 1
NCBI Official Symbol
HACD1
NCBI Official Synonym Symbols
CAP; PTPLA
NCBI Protein Information
very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 1
UniProt Protein Name
Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 1
UniProt Gene Name
HACD1
UniProt Synonym Gene Names
CAP
UniProt Entry Name
HACD1_HUMAN

NCBI Description

The protein encoded by this gene contains a characteristic catalytic motif of the protein tyrosine phosphatases (PTPs) family. The PTP motif of this protein has the highly conserved arginine residue replaced by a proline residue; thus it may represent a distinct class of PTPs. Members of the PTP family are known to be signaling molecules that regulate a variety of cellular processes. This gene was preferentially expressed in both adult and fetal heart. A much lower expression level was detected in skeletal and smooth muscle tissues, and no expression was observed in other tissues. The tissue specific expression in the developing and adult heart suggests a role in regulating cardiac development and differentiation. [provided by RefSeq, Jul 2008]

Uniprot Description

PTPLA: Responsible for the dehydration step in very long-chain fatty acids (VLCFAs) synthesis. Belongs to the very long-chain fatty acids dehydratase HACD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Motility/polarity/chemotaxis; EC 4.2.1.134; Membrane protein, integral

Chromosomal Location of Human Ortholog: 10p12.33

Cellular Component: endoplasmic reticulum membrane

Research Articles on PTPLA

Similar Products

Product Notes

The PTPLA hacd1 (Catalog #AAA1267969) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcgcc tgacggaagc ggcggcagcg ggcagcggct ctcgggctgc aggctgggca gggtcccctc ccacgctcct gccgctgtct cccacgtccc ccaggtgcgc ggccaccatg gcgtccagcg acgaggacgg caccaacggc ggcgcctcgg aggccggcga ggaccgggag gctcccggca agcggaggcg cctggggttc ttggccaccg cctggctcac cttctacgac atcgccatga ccgcggggtg gttggttcta gctattgcca tggtacgttt ttatatggaa aaaggaacac acagaggttt atataaaagt attcagaaga cacttaaatt tttccagaca tttgccttgc ttgagatagt tcactgttta attggaattg tacctacttc tgtgattgtg actggggtcc aagtgagttc aagaatcttt atggtgtggc tcattactca cagtataaaa ccaatccaga atgaagagag tgtggtgctt tttctggtcg cgtggactgt gacagagatc actcgctatt ccttctacac attcagcctt cttgaccact tgccatactt cattaaatgg gccagatata atttttttat catcttatat cctgttggag ttgctggtga acttcttaca atatacgctg ccttgccgca tgtgaagaaa acaggaatgt tttcaataag acttcctaac aaatacaatg tctcttttga ctactattat tttcttctta taaccatggc atcatatata cctttgtttc cacaactcta ttttcatatg ttacgtcaaa gaagaaaggt gcttcatgga gaggtgattg tagaaaagga tgattaa. It is sometimes possible for the material contained within the vial of "PTPLA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.