Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTBP1 cdna clone

PTBP1 cDNA Clone

Gene Names
PTBP1; PTB; PTB2; PTB3; PTB4; pPTB; HNRPI; PTB-1; PTB-T; HNRNPI; HNRNP-I
Synonyms
PTBP1; PTBP1 cDNA Clone; PTBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacggcattgtcccagatatagccgttggtacaaagcggggatctgacgagcttttctctacttgtgtcactaacggaccgtttatcatgagcagcaactcggcttctgcagcaaacggaaatgacagcaagaagttcaaaggtgacagccgaagtgcaggcgtcccctctagagtgatccacatccggaagctccccatcgacgtcacggagggggaagtcatctccctggggctgccctttgggaaggtcaccaacctcctgatgctgaaggggaaaaaccaggccttcatcgagatgaacacggaggaggctgccaacaccatggtgaactactacacctcggtgacccctgtgctgcgcggccagcccatctacatccagttctccaaccacaaggagctgaagaccgacagctctcccaaccaggcgcgggcccaggcggccctgcaggcggtgaactcggtccagtcggggaacctggccttggctgcctcggcggcggccgtggacgcagggatggcgatggccgggcagagccccgtgctcaggatcatcgtggagaacctcttctaccctgtgaccctggatgtgctgcaccagattttctccaagttcggcacagtgttgaagatcatcaccttcaccaagaacaaccagttccaggccctgctgcagtatgcggaccccgtgagcgcccagcacgccaagctgtcgctggacgggcagaacatctacaacgcctgctgcacgctgcgcatcgacttttccaagctcaccagcctcaacgtcaagtacaacaatgacaagagccgtgactacacacgcccagacctgccttccggggacagccagccctcgctggaccagaccatggccgcggccttcggcctttccgttccgaacgtccacggcgccctggcccccctggccatcccctcggcggcggcggcagctgcggcggcaggtcggatcgccatcccgggcctggcgggggcaggaaattctgtattgctggtcagcaacctcaacccagagagagtcacaccccaaagcctctttattcttttcggcgtctacggtgacgtgcagcgcgtgaagatcctgttcaataagaaggagaacgccctagtgcagatggcggacggcaaccaggcccagctggccatgagccacctgaacgggcacaagctgcacgggaagcccatccgcatcacgctctcgaagcaccagaacgtgcagctgccccgcgagggccaggaggaccagggcctgaccaaggactacggcaactcacccctgcaccgcttcaagaagccgggctccaagaacttccagaacatattcccgccctcggccacgctgcacctctccaacatcccgccctcagtctccgaggaggatctcaaggtcctgttttccagcaatgggggcgtcgtcaaaggattcaagttcttccagaaggaccgcaagatggcactgatccagatgggctccgtggaggaggcggtccaggccctcattgacctgcacaaccacgacctcggggagaaccaccacctgcgggtctccttctccaagtccaccatctag
Sequence Length
1596
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,633 Da
NCBI Official Full Name
Homo sapiens polypyrimidine tract binding protein 1, mRNA
NCBI Official Synonym Full Names
polypyrimidine tract binding protein 1
NCBI Official Symbol
PTBP1
NCBI Official Synonym Symbols
PTB; PTB2; PTB3; PTB4; pPTB; HNRPI; PTB-1; PTB-T; HNRNPI; HNRNP-I
NCBI Protein Information
polypyrimidine tract-binding protein 1
UniProt Protein Name
Polypyrimidine tract-binding protein 1
UniProt Gene Name
PTBP1
UniProt Synonym Gene Names
PTB; PTB; hnRNP I
UniProt Entry Name
PTBP1_HUMAN

NCBI Description

This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

hnRNP I: a ubiquitously expressed heterogeneous nuclear ribonucleoprotein (hnRNP). hnRNPs are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. Binds to the polypyrimidine tract of introns. May promote the binding of U2 snRNP to pre-mRNA. Two alternatively spliced isoforms have been described.

Protein type: RNA splicing; RNA-binding

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: membrane; nucleolus; nucleoplasm

Molecular Function: poly-pyrimidine tract binding; protein binding; RNA binding

Biological Process: fibroblast growth factor receptor signaling pathway; gene expression; mRNA processing; negative regulation of muscle cell differentiation; negative regulation of nuclear mRNA splicing, via spliceosome; negative regulation of RNA splicing; nuclear mRNA splicing, via spliceosome; regulation of alternative nuclear mRNA splicing, via spliceosome; RNA splicing

Research Articles on PTBP1

Similar Products

Product Notes

The PTBP1 ptbp1 (Catalog #AAA1265654) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacggca ttgtcccaga tatagccgtt ggtacaaagc ggggatctga cgagcttttc tctacttgtg tcactaacgg accgtttatc atgagcagca actcggcttc tgcagcaaac ggaaatgaca gcaagaagtt caaaggtgac agccgaagtg caggcgtccc ctctagagtg atccacatcc ggaagctccc catcgacgtc acggaggggg aagtcatctc cctggggctg ccctttggga aggtcaccaa cctcctgatg ctgaagggga aaaaccaggc cttcatcgag atgaacacgg aggaggctgc caacaccatg gtgaactact acacctcggt gacccctgtg ctgcgcggcc agcccatcta catccagttc tccaaccaca aggagctgaa gaccgacagc tctcccaacc aggcgcgggc ccaggcggcc ctgcaggcgg tgaactcggt ccagtcgggg aacctggcct tggctgcctc ggcggcggcc gtggacgcag ggatggcgat ggccgggcag agccccgtgc tcaggatcat cgtggagaac ctcttctacc ctgtgaccct ggatgtgctg caccagattt tctccaagtt cggcacagtg ttgaagatca tcaccttcac caagaacaac cagttccagg ccctgctgca gtatgcggac cccgtgagcg cccagcacgc caagctgtcg ctggacgggc agaacatcta caacgcctgc tgcacgctgc gcatcgactt ttccaagctc accagcctca acgtcaagta caacaatgac aagagccgtg actacacacg cccagacctg ccttccgggg acagccagcc ctcgctggac cagaccatgg ccgcggcctt cggcctttcc gttccgaacg tccacggcgc cctggccccc ctggccatcc cctcggcggc ggcggcagct gcggcggcag gtcggatcgc catcccgggc ctggcggggg caggaaattc tgtattgctg gtcagcaacc tcaacccaga gagagtcaca ccccaaagcc tctttattct tttcggcgtc tacggtgacg tgcagcgcgt gaagatcctg ttcaataaga aggagaacgc cctagtgcag atggcggacg gcaaccaggc ccagctggcc atgagccacc tgaacgggca caagctgcac gggaagccca tccgcatcac gctctcgaag caccagaacg tgcagctgcc ccgcgagggc caggaggacc agggcctgac caaggactac ggcaactcac ccctgcaccg cttcaagaag ccgggctcca agaacttcca gaacatattc ccgccctcgg ccacgctgca cctctccaac atcccgccct cagtctccga ggaggatctc aaggtcctgt tttccagcaa tgggggcgtc gtcaaaggat tcaagttctt ccagaaggac cgcaagatgg cactgatcca gatgggctcc gtggaggagg cggtccaggc cctcattgac ctgcacaacc acgacctcgg ggagaaccac cacctgcggg tctccttctc caagtccacc atctag. It is sometimes possible for the material contained within the vial of "PTBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.