Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNPLA6 cdna clone

PNPLA6 cDNA Clone

Gene Names
PNPLA6; NTE; sws; BNHS; LNMS; OMCS; SPG39; NTEMND; iPLA2delta
Synonyms
PNPLA6; PNPLA6 cDNA Clone; PNPLA6 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggctccgctgcaaactggaatggtgcttggcgtgatgatcggggccggagtggcggtggtggtcacggccgtgctcatcctcctggtggtgcggaggctgcgagtgccaaaaaccccagccccggatggcccccggtatcggttccggaagagggacaaagtgctcttctatggccggaagattatgcggaaggtgtcacaatccacctcctccctcgtggatacctctgtctccgccacctcccggccacgcatgaggaagaaactgaagatgctcaacattgccaagaagatcctgcgcatccagaaagagacgcccacgctgcagcggaaggagcccccgcccgcagtgctagaagctgacctgaccgagggcgacctggctaactcccatctgccctctgaagtgctttatatgctcaagaacgtccgggtgctgggccacttcgagaagccactcttcctggagctctgccgccacatggtcttccagcggctgggccagggtgactacgtcttccggccgggccagccagatgccagcatctacgtggtgcaggacgggctgctggagctctgtctgccagggcctgacgggaaggagtgtgtggtgaaggaagtggttcctggggacagcgtcaacagccttctcagcatcctggatgtcatcaccggtcaccagcatccccagcggaccgtgtctgcccgggcggcccgggactccacggtgctgcgcctgccggtggaagcattctccgcggtcttcaccaagtacccggagagcttggtgcgggtcgtgcagatcatcatggtgcggctgcagcgagtcaccttcctggcactgcacaactacctgggtctgaccaatgagctcttcagccacgagatccagcccctgcgtctgttccccagccccggcctcccaactcgcaccagccctgtgcggggctccaagagaatggtcagcacctcagctacagacgagcccagggagaccccagggcggccacccgatcccaccggggccccgctgcctggacctacaggggaccctgtgaagcccacatccctggaaaccccctcggcccctctgctgagccgctgcgtctccatgccaggggacatctcaggcttgcagggtggcccccgctccgacttcgacatggcctatgagcgtggccggatctccgtgtccctgcaggaagaggcctccggggggtccctggcagcccccgctcggacccccactcaggagcctcgtgagcagccggcaggcgcctgtgaatacagctactgtgaggatgagtcggccactggtggctgccctttcgggccctaccagggccgccagaccagcagcatcttcgaggcagcaaagcaggagctggccaagctgatgcggattgaggacccctccctcctgaacagcagagtcttgctgcaccacgccaaagctggcaccatcattgcccgccagggagaccaggacgtgagcctgcacttcgtgctctggggctgcctgcacgtgtaccagcgcatgatcgacaaggcggaggacgtgtgcctgttcgtagcgcagcccggggaactggtggggcagctggcggtgctcactggcgaacctctcatcttcacactgcgagcccaacgcgactgcaccttcctgcggatctccaagtccgacttctatgagatcatgcgcgcacagcccagtgtggtgctgagtgcggcgcacacggtggcagccaggatgtcgcccttcgtgcgccagatggacttcgccatcgactggactgcagtggaggcgggacgcgcgctgtacaggcagggcgaccgctccgactgcacttacatcgtgctcaatgggcggctgcgtagcgtgatccagcgaggcagtggcaagaaggagctggtgggcgagtacggccgcggcgacctcatcggcgtggtggaggcactgacccggcagccgcgagccacgacggtgcacgcggtgcgcgacacggagctggccaagcttcccgagggcaccttgggtcacatcaaacgccggtacccgcaggtcgtgacccgccttatccacctactgagccagaaaattctagggaatttgcagcagctgcaaggacccttcccagcaggctctgggttgggtgtgcccccacactcggaactcaccaacccagccagcaacctggcaactgtggcaatcctgcctgtgtgtgctgaggtccccatggtggccttcacgctggagctgcagcacgccctgcaggccatcggtccgacgctactccttaacagtgacatcatccgggcacgcctgggggcctccgcactggatagcatccaagagttccggctgtcagggtggctggcccagcaggaggatgcacaccgtatcgtactctaccagacggacgcctcgctgacgccctggaccgtgcgctgcctgcgacaggccgactgcatcctcattgtgggcctgggggaccaggagcctaccctcggccagctggagcagatgctggagaacacggctgtgcgcgcccttaagcagctagtcctgctccaccgagaggagggcgcgggccccacgcgcaccgtggagtggctaaatatgcgcagctggtgctcggggcacctgcacctgcgctgtccgcgccgcctcttttcgcgccgcagccctgccaagctgcatgagctctacgagaaggttttctccaggcgcgcggaccggcacagcgacttctcccgcttggcgagggtgctcacggggaacaccattgcccttgtgctaggcgggggcggggccaggggctgctcgcacatcggagtactaaaggcattagaggaggcgggggtccccgtggacctggtgggcggcacgtccattggctctttcatcggagcgttgtacgcggaggagcgcagcgccagccgcacgaagcagcgggcccgggagtgggccaagagcatgacttcggtgctggaacctgtgttggacctcacgtacccagtcacctccatgttcactgggtctgcctttaaccgcagcatccatcgggtcttccaggataagcagattgaggacctgtggctgccttacttcaacgtgaccacagatatcaccgcctcagccatgcgagtccacaaagatggctccctgtggcggtacgtgcgcgccagcatgacgctgtcgggctacctgcccccgctgtgcgaccccaaggacgggcacctactcatggatggcggctacatcaacaatctgccagcggacatcgcccgcagcatgggtgccaaaacggtcatcgccattgacgtggggagccaggatgagacggacctcagcacctacggggacagcctgtccggctggtggctgctgtggaagcggctgaatccctgggctgacaaggtaaaggttccagacatggctgaaatccagtcccgcctggcctacgtgtcctgtgtgcggcagctagaggttgtcaagtccagctcctactgcgagtacctgcgcccgcccatcgactgcttcaagaccatggactttgggaagttcgaccagatctatgatgtgggctaccagtacgggaaggcggtgtttggaggctggagccgtggcaacgtcattgagaaaatgctcacagaccggcggtctacagaccttaatgagagccgccgtgcagacgtgcttgccttcccaagctctggcttcactgacttggcagagattgtgtcccggattgagccccccacgagctatgtctctgatggctgtgctgacggagaggagtcagattgtctgacagagtatgaggaggacgccggacccgactgctcgagggatgaaggggggtcccccgagggcgcaagccccagcactgcctccgagatggaggaggagaagtcgattctccggcaacgacgctgtctgccccaggagccgcccggctcagccacagatgcctga
Sequence Length
3984
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
143,351 Da
NCBI Official Full Name
Homo sapiens patatin-like phospholipase domain containing 6, mRNA
NCBI Official Synonym Full Names
patatin like phospholipase domain containing 6
NCBI Official Symbol
PNPLA6
NCBI Official Synonym Symbols
NTE; sws; BNHS; LNMS; OMCS; SPG39; NTEMND; iPLA2delta
NCBI Protein Information
neuropathy target esterase
UniProt Protein Name
Neuropathy target esterase
UniProt Gene Name
PNPLA6
UniProt Synonym Gene Names
NTE
UniProt Entry Name
PLPL6_HUMAN

NCBI Description

This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

NTE: Phospholipase B that deacylates intracellular phosphatidylcholine (PtdCho), generating glycerophosphocholine (GroPtdCho). This deacylation occurs at both sn-2 and sn-1 positions of PtdCho. Its specific chemical modification by certain organophosphorus (OP) compounds leads to distal axonopathy. Defects in PNPLA6 are the cause of spastic paraplegia autosomal recessive type 39 (SPG39); also known as NTE-related motor neuron disorder (NTEMND). Spastic paraplegia is a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. SPG39 is associated with a motor axonopathy affecting upper and lower limbs and resulting in progressive wasting of distal upper and lower extremity muscles. Belongs to the NTE family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.1.1.5; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane

Molecular Function: lysophospholipase activity

Biological Process: developmental process; glycerophospholipid catabolic process

Disease: Boucher-neuhauser Syndrome; Laurence-moon Syndrome; Oliver-mcfarlane Syndrome; Spastic Paraplegia 39, Autosomal Recessive

Research Articles on PNPLA6

Similar Products

Product Notes

The PNPLA6 pnpla6 (Catalog #AAA1275599) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggctc cgctgcaaac tggaatggtg cttggcgtga tgatcggggc cggagtggcg gtggtggtca cggccgtgct catcctcctg gtggtgcgga ggctgcgagt gccaaaaacc ccagccccgg atggcccccg gtatcggttc cggaagaggg acaaagtgct cttctatggc cggaagatta tgcggaaggt gtcacaatcc acctcctccc tcgtggatac ctctgtctcc gccacctccc ggccacgcat gaggaagaaa ctgaagatgc tcaacattgc caagaagatc ctgcgcatcc agaaagagac gcccacgctg cagcggaagg agcccccgcc cgcagtgcta gaagctgacc tgaccgaggg cgacctggct aactcccatc tgccctctga agtgctttat atgctcaaga acgtccgggt gctgggccac ttcgagaagc cactcttcct ggagctctgc cgccacatgg tcttccagcg gctgggccag ggtgactacg tcttccggcc gggccagcca gatgccagca tctacgtggt gcaggacggg ctgctggagc tctgtctgcc agggcctgac gggaaggagt gtgtggtgaa ggaagtggtt cctggggaca gcgtcaacag ccttctcagc atcctggatg tcatcaccgg tcaccagcat ccccagcgga ccgtgtctgc ccgggcggcc cgggactcca cggtgctgcg cctgccggtg gaagcattct ccgcggtctt caccaagtac ccggagagct tggtgcgggt cgtgcagatc atcatggtgc ggctgcagcg agtcaccttc ctggcactgc acaactacct gggtctgacc aatgagctct tcagccacga gatccagccc ctgcgtctgt tccccagccc cggcctccca actcgcacca gccctgtgcg gggctccaag agaatggtca gcacctcagc tacagacgag cccagggaga ccccagggcg gccacccgat cccaccgggg ccccgctgcc tggacctaca ggggaccctg tgaagcccac atccctggaa accccctcgg cccctctgct gagccgctgc gtctccatgc caggggacat ctcaggcttg cagggtggcc cccgctccga cttcgacatg gcctatgagc gtggccggat ctccgtgtcc ctgcaggaag aggcctccgg ggggtccctg gcagcccccg ctcggacccc cactcaggag cctcgtgagc agccggcagg cgcctgtgaa tacagctact gtgaggatga gtcggccact ggtggctgcc ctttcgggcc ctaccagggc cgccagacca gcagcatctt cgaggcagca aagcaggagc tggccaagct gatgcggatt gaggacccct ccctcctgaa cagcagagtc ttgctgcacc acgccaaagc tggcaccatc attgcccgcc agggagacca ggacgtgagc ctgcacttcg tgctctgggg ctgcctgcac gtgtaccagc gcatgatcga caaggcggag gacgtgtgcc tgttcgtagc gcagcccggg gaactggtgg ggcagctggc ggtgctcact ggcgaacctc tcatcttcac actgcgagcc caacgcgact gcaccttcct gcggatctcc aagtccgact tctatgagat catgcgcgca cagcccagtg tggtgctgag tgcggcgcac acggtggcag ccaggatgtc gcccttcgtg cgccagatgg acttcgccat cgactggact gcagtggagg cgggacgcgc gctgtacagg cagggcgacc gctccgactg cacttacatc gtgctcaatg ggcggctgcg tagcgtgatc cagcgaggca gtggcaagaa ggagctggtg ggcgagtacg gccgcggcga cctcatcggc gtggtggagg cactgacccg gcagccgcga gccacgacgg tgcacgcggt gcgcgacacg gagctggcca agcttcccga gggcaccttg ggtcacatca aacgccggta cccgcaggtc gtgacccgcc ttatccacct actgagccag aaaattctag ggaatttgca gcagctgcaa ggacccttcc cagcaggctc tgggttgggt gtgcccccac actcggaact caccaaccca gccagcaacc tggcaactgt ggcaatcctg cctgtgtgtg ctgaggtccc catggtggcc ttcacgctgg agctgcagca cgccctgcag gccatcggtc cgacgctact ccttaacagt gacatcatcc gggcacgcct gggggcctcc gcactggata gcatccaaga gttccggctg tcagggtggc tggcccagca ggaggatgca caccgtatcg tactctacca gacggacgcc tcgctgacgc cctggaccgt gcgctgcctg cgacaggccg actgcatcct cattgtgggc ctgggggacc aggagcctac cctcggccag ctggagcaga tgctggagaa cacggctgtg cgcgccctta agcagctagt cctgctccac cgagaggagg gcgcgggccc cacgcgcacc gtggagtggc taaatatgcg cagctggtgc tcggggcacc tgcacctgcg ctgtccgcgc cgcctctttt cgcgccgcag ccctgccaag ctgcatgagc tctacgagaa ggttttctcc aggcgcgcgg accggcacag cgacttctcc cgcttggcga gggtgctcac ggggaacacc attgcccttg tgctaggcgg gggcggggcc aggggctgct cgcacatcgg agtactaaag gcattagagg aggcgggggt ccccgtggac ctggtgggcg gcacgtccat tggctctttc atcggagcgt tgtacgcgga ggagcgcagc gccagccgca cgaagcagcg ggcccgggag tgggccaaga gcatgacttc ggtgctggaa cctgtgttgg acctcacgta cccagtcacc tccatgttca ctgggtctgc ctttaaccgc agcatccatc gggtcttcca ggataagcag attgaggacc tgtggctgcc ttacttcaac gtgaccacag atatcaccgc ctcagccatg cgagtccaca aagatggctc cctgtggcgg tacgtgcgcg ccagcatgac gctgtcgggc tacctgcccc cgctgtgcga ccccaaggac gggcacctac tcatggatgg cggctacatc aacaatctgc cagcggacat cgcccgcagc atgggtgcca aaacggtcat cgccattgac gtggggagcc aggatgagac ggacctcagc acctacgggg acagcctgtc cggctggtgg ctgctgtgga agcggctgaa tccctgggct gacaaggtaa aggttccaga catggctgaa atccagtccc gcctggccta cgtgtcctgt gtgcggcagc tagaggttgt caagtccagc tcctactgcg agtacctgcg cccgcccatc gactgcttca agaccatgga ctttgggaag ttcgaccaga tctatgatgt gggctaccag tacgggaagg cggtgtttgg aggctggagc cgtggcaacg tcattgagaa aatgctcaca gaccggcggt ctacagacct taatgagagc cgccgtgcag acgtgcttgc cttcccaagc tctggcttca ctgacttggc agagattgtg tcccggattg agccccccac gagctatgtc tctgatggct gtgctgacgg agaggagtca gattgtctga cagagtatga ggaggacgcc ggacccgact gctcgaggga tgaagggggg tcccccgagg gcgcaagccc cagcactgcc tccgagatgg aggaggagaa gtcgattctc cggcaacgac gctgtctgcc ccaggagccg cccggctcag ccacagatgc ctga. It is sometimes possible for the material contained within the vial of "PNPLA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.