PHF20L1 cdna clone
PHF20L1 cDNA Clone
Gene Names
PHF20L1; URLC1; CGI-72; TDRD20B
Synonyms
PHF20L1; PHF20L1 cDNA Clone; PHF20L1 cdna clone
Sequence
atgagtaaaaagcccccaaatcgccctggaatcacttttgagattggtgctcgtttggaggcactggactacttacaaaaatggtatccatcacgaattgaaaaaattgactatgaggagggcaagatgttggtccattttgagcgctggagtcatcgttatgatgagtggatttactgggatagcaatagattgcgaccccttgagagaccagcactaagaaaagaagggctaaaagatgaggaagatttctttgattttaaagctggagaagaagttctggctcgttggacagactgtcgctattaccctgccaagattgaagcaattaacaaagaaggaacatttacagttcagttttatgatggagtaattcgttgtttaaaaagaatgcacattaaagccatgcccgaggatgctaaggggcaggattggatagctttagtcaaagcagctgctgcagctgcagccaagaacaaaacagggagtaaacctcgaaccagcgctaacagcaataaagataaggataaagatgagagaaagtggtttaaagtaccttcaaagaaggaggaaacttcaacttgtatagccacaccagacgtagagaagaaggaagatctgcctacatctagtgaaacatttggacttcatgtagagaacgttccaaagatggtctttccacagccagagagcacattatcaaacaagaggaaaaataatcaaggcaactcgtttcaggcaaagagagctcgacttaacaagattactggtttgttggcatccaaagctgttggggttgatggtgctgaaaaaaaggaagactacaatgaaacagctccaatgctggagcaggtatga
Sequence Length
858
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
63,487 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 20-like 1, mRNA
NCBI Official Synonym Full Names
PHD finger protein 20-like 1
NCBI Official Symbol
PHF20L1
NCBI Official Synonym Symbols
URLC1; CGI-72; TDRD20B
NCBI Protein Information
PHD finger protein 20-like protein 1
UniProt Protein Name
PHD finger protein 20-like protein 1
Protein Family
UniProt Gene Name
PHF20L1
UniProt Entry Name
P20L1_HUMAN
Uniprot Description
PHF20L1: 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 8q24.22
Molecular Function: protein binding
Research Articles on PHF20L1
Similar Products
Product Notes
The PHF20L1 phf20l1 (Catalog #AAA1271953) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtaaaa agcccccaaa tcgccctgga atcacttttg agattggtgc tcgtttggag gcactggact acttacaaaa atggtatcca tcacgaattg aaaaaattga ctatgaggag ggcaagatgt tggtccattt tgagcgctgg agtcatcgtt atgatgagtg gatttactgg gatagcaata gattgcgacc ccttgagaga ccagcactaa gaaaagaagg gctaaaagat gaggaagatt tctttgattt taaagctgga gaagaagttc tggctcgttg gacagactgt cgctattacc ctgccaagat tgaagcaatt aacaaagaag gaacatttac agttcagttt tatgatggag taattcgttg tttaaaaaga atgcacatta aagccatgcc cgaggatgct aaggggcagg attggatagc tttagtcaaa gcagctgctg cagctgcagc caagaacaaa acagggagta aacctcgaac cagcgctaac agcaataaag ataaggataa agatgagaga aagtggttta aagtaccttc aaagaaggag gaaacttcaa cttgtatagc cacaccagac gtagagaaga aggaagatct gcctacatct agtgaaacat ttggacttca tgtagagaac gttccaaaga tggtctttcc acagccagag agcacattat caaacaagag gaaaaataat caaggcaact cgtttcaggc aaagagagct cgacttaaca agattactgg tttgttggca tccaaagctg ttggggttga tggtgctgaa aaaaaggaag actacaatga aacagctcca atgctggagc aggtatga. It is sometimes possible for the material contained within the vial of "PHF20L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
