NOTUM cdna clone
NOTUM cDNA Clone
Gene Names
NOTUM; hNOTUM
Synonyms
NOTUM; NOTUM cDNA Clone; NOTUM cdna clone
Sequence
atggcgcaagtcaagagcctggcgcagtccctgtacccctgctccgcgcagcagctcaacgaggacctgcgcctgcacctcctactcaacacctcggtgacctgcaacgacggcagccccgccggctactacctgaaggagtccaggggcagccggcggtggctcctcttcctggaaggcggctggtactgcttcaaccgcgagaactgcgactccagatacgacaccatgcggcgcctcatgagctcccgggactggccgcgcactcgcacaggcacagggatcctgtcctcacagccggaggagaacccctactggtggaacgcaaacatggtcttcatcccctactgctccagtgatgtttggagcggggcttcatccaagtctgagaagaacgagtacgccttcatgggcgccctcatcatccaggaggtggtgcgggagcttctgggcagagggctgagcggggccaaggtgctgctgctggccgggagcagcgcggggggcaccggggtgctcctgaatgtggaccgtgtggctgagcagctggagaagctgggctacccagccatccaggtgcgaggcctggctgactccggctggttcctggacaacaagcagtatcgccacacagactgcgtcgacacgatcacgtgcgcgcccacggaggccatccgccgtggcatcaggtactggaacggggtggtcccggagcgctgccgacgccagttccaggagggcgaggagtggaactgcttctttggctacaaggtctacccgaccctgcgctgccctgtgttcgtggtgcagtggctgtttgacgaggcacagctgacggtggacaacgtgcacctgacggggcagccggtgcaggagggcctgcggctgtacatccagaacctcggccgcgagctgcgccacacactcaaggacgtgccggccagctttgcccccgcctgcctctcccatgagatcatcatccggagccactggacggatgtccaggtgaaggggacgtcgctgccccgagcactgcactgctgggacaggagcctccatgacagccacaaggccagcaagacccccctcaagggctgccccgtccacctggtggacagctgcccctggccccactgcaacccctcatgccccaccgtccgagaccagttcacggggcaagagatgaacgtggcccagttcctcatgcacatgggcttcgacatgcagacggtggcccagccgcagggactggagcccagtgagctgctggggatgctgagcaacggaagctag
Sequence Length
1293
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,699 Da
NCBI Official Full Name
Homo sapiens notum pectinacetylesterase homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
NOTUM, palmitoleoyl-protein carboxylesterase
NCBI Official Symbol
NOTUM
NCBI Official Synonym Symbols
hNOTUM
NCBI Protein Information
palmitoleoyl-protein carboxylesterase NOTUM
UniProt Protein Name
Palmitoleoyl-protein carboxylesterase NOTUM
Protein Family
UniProt Gene Name
NOTUM
UniProt Entry Name
NOTUM_HUMAN
Uniprot Description
NOTUM: May deacetylate GlcNAc residues on cell surface glycans (Potential). Belongs to the pectinacetylesterase family.
Protein type: EC 3.-.-.-; Hydrolase; Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 17q25.3
Cellular Component: extracellular region
Molecular Function: phospholipase C activity
Biological Process: negative regulation of Wnt receptor signaling pathway
Research Articles on NOTUM
Similar Products
Product Notes
The NOTUM notum (Catalog #AAA1274194) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcaag tcaagagcct ggcgcagtcc ctgtacccct gctccgcgca gcagctcaac gaggacctgc gcctgcacct cctactcaac acctcggtga cctgcaacga cggcagcccc gccggctact acctgaagga gtccaggggc agccggcggt ggctcctctt cctggaaggc ggctggtact gcttcaaccg cgagaactgc gactccagat acgacaccat gcggcgcctc atgagctccc gggactggcc gcgcactcgc acaggcacag ggatcctgtc ctcacagccg gaggagaacc cctactggtg gaacgcaaac atggtcttca tcccctactg ctccagtgat gtttggagcg gggcttcatc caagtctgag aagaacgagt acgccttcat gggcgccctc atcatccagg aggtggtgcg ggagcttctg ggcagagggc tgagcggggc caaggtgctg ctgctggccg ggagcagcgc ggggggcacc ggggtgctcc tgaatgtgga ccgtgtggct gagcagctgg agaagctggg ctacccagcc atccaggtgc gaggcctggc tgactccggc tggttcctgg acaacaagca gtatcgccac acagactgcg tcgacacgat cacgtgcgcg cccacggagg ccatccgccg tggcatcagg tactggaacg gggtggtccc ggagcgctgc cgacgccagt tccaggaggg cgaggagtgg aactgcttct ttggctacaa ggtctacccg accctgcgct gccctgtgtt cgtggtgcag tggctgtttg acgaggcaca gctgacggtg gacaacgtgc acctgacggg gcagccggtg caggagggcc tgcggctgta catccagaac ctcggccgcg agctgcgcca cacactcaag gacgtgccgg ccagctttgc ccccgcctgc ctctcccatg agatcatcat ccggagccac tggacggatg tccaggtgaa ggggacgtcg ctgccccgag cactgcactg ctgggacagg agcctccatg acagccacaa ggccagcaag acccccctca agggctgccc cgtccacctg gtggacagct gcccctggcc ccactgcaac ccctcatgcc ccaccgtccg agaccagttc acggggcaag agatgaacgt ggcccagttc ctcatgcaca tgggcttcga catgcagacg gtggcccagc cgcagggact ggagcccagt gagctgctgg ggatgctgag caacggaagc tag. It is sometimes possible for the material contained within the vial of "NOTUM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
