NHP2 cdna clone

NHP2

Cat. Num. AAA200687

• Gene Names: NHP2; DKCB2; NHP2P; NOLA2
• Synonyms: NHP2; DKCB2; NHP2P; NOLA2; NHP2 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGACCAAAATAAAGGCAGATCCCGACGGGCCCGAGGCTCAGGCGGAGGCGTGTTCCGGGGAGCGCACCTACCAGGAGCTGCTGGTCAACCAGAACCCCATCGCGCAGCCCCTGGCTTCTCGCCGCCTCACGCGGAAGCTCTACAAATGCATCAAGAAAGCGGTGAAGCAGAAGCAGATTCGGCGCGGGGTGAAAGAGGTTCAGAAATTTGTCAACAAAGGAGAAAAAGGGATCATGGTTTTGGCAGGAGACACACTGCCCATTGAGGTATACTGCCATCTCCCAGTCATGTGTGAGGACCGAAATTTGCCCTATGTCTATATCCCCTCTAAGACGGACCTGGGTGCAGCCGCAGGCTCCAAGCGCCCCACCTGTGTGATAATGGTCAAGCCCCATGAGGAGTACCAGGAGGCTTACGATGAGTGCCTGGAGGAGGTGCAGTCCCTGCCCCTACCCCTATGA; ; Translation Sequence: MTKIKADPDG PEAQAEACSG ERTYQELLVN QNPIAQPLAS RRLTRKLYKC IKKAVKQKQI RRGVKEVQKF VNKGEKGIMV LAGDTLPIEV YCHLPVMCED RNLPYVYIPS KTDLGAAAGS KRPTCVIMVK PHEEYQEAYD ECLEEVQSLP LPL
• Sequence Length: 153

• Species: Human
• Chromosome Location: 5q35.3
• OMIM Reference Number: 606470
• cDNA Size: 462bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for NHP2 cdna clone

NHP2 is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants.

Product Categories/Family for NHP2 cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 8923444
• NCBI GeneID: 55651
• NCBI Accession #: NP_060308.1
• NCBI GenBank Nucleotide #: NM_017838.3
• UniProt Accession #: Q9NX24
• NCBI Official Full Name: H/ACA ribonucleoprotein complex subunit 2 isoform a
• NCBI Official Synonym Full Names: NHP2 ribonucleoprotein
• NCBI Official Symbol: NHP2
• NCBI Official Synonym Symbols: DKCB2; NHP2P; NOLA2
• NCBI Protein Information: H/ACA ribonucleoprotein complex subunit 2
• UniProt Protein Name: H/ACA ribonucleoprotein complex subunit 2
• Protein Family: NHP2-like protein
• UniProt Gene Name: NHP2
• UniProt Synonym Gene Names: NOLA2
• UniProt Entry Name: NHP2_HUMAN

NCBI Description

This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]

Uniprot Description

NOLA2: Required for ribosome biogenesis and telomere maintenance. Part of the H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA. This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine (psi) residues, which may serve to stabilize the conformation of rRNAs. May also be required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme. Defects in NHP2 are the cause of dyskeratosis congenita autosomal recessive type 2 (DKCB2). A rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. Belongs to the ribosomal protein L7Ae family.

Protein type: Nucleolus

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: nucleoplasm; Cajal body; small nucleolar ribonucleoprotein complex; cytoplasm; nucleolus

Molecular Function: snoRNA binding

Biological Process: rRNA pseudouridine synthesis

Disease: Dyskeratosis Congenita, Autosomal Recessive, 2; Dyskeratosis Congenita, Autosomal Recessive, 1