Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEA12 cdna clone

MAGEA12 cDNA Clone

Gene Names
MAGEA12; CT1.12; MAGE12
Synonyms
MAGEA12; MAGEA12 cDNA Clone; MAGEA12 cdna clone
Ordering
For Research Use Only!
Sequence
atgccacttgagcagaggagtcagcactgcaagcctgaggaaggccttgaggcccaaggagaggccctgggcttggtgggtgcgcaggctcctgctactgaggagcaggagactgcctcctcctcctctactctagtggaagtcaccctgcgggaggtgcctgctgccgagtcaccaagtcctccccacagtcctcagggagcctccaccctccccactaccatcaactatactctctggagtcaatccgatgagggctccagcaacgaagaacaggaagggccaagcacctttcctgacctggagacgagcttccaagtagcactcagtaggaagatggctgagttggttcattttctgctcctcaagtatcgagccagggagccattcacaaaggcagaaatgctggggagtgtcatcagaaatttccaggacttctttcctgtgatcttcagcaaagcctccgagtacttgcagctggtctttggcatcgaggtggtggaagtggtccgcatcggccacttgtacatccttgtcacctgcctgggcctctcctacgatggcctgctgggcgacaatcagatcgtgcccaagacaggcctcctgataatcgtcctggccataatcgcaaaagagggcgactgtgcccctgaggagaaaatctgggaggagctgagtgtgttggaggcatctgatgggagggaggacagtgtctttgcgcatcccaggaagctgctcacccaagatttggtgcaggaaaactacctggagtaccggcaggtccccggcagtgatcctgcatgctacgagttcctgtggggtccaagggccctcgttgaaaccagctatgtgaaagtcctgcaccatttgctaaagatcagtggaggacctcacatttcctacccacccctgcatgaatgggcttttagagagggggaagagtga
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,836 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family A, 12, mRNA
NCBI Official Synonym Full Names
MAGE family member A12
NCBI Official Symbol
MAGEA12
NCBI Official Synonym Symbols
CT1.12; MAGE12
NCBI Protein Information
melanoma-associated antigen 12
UniProt Protein Name
Melanoma-associated antigen 12
UniProt Gene Name
MAGEA12
UniProt Synonym Gene Names
MAGE12; CT1.12
UniProt Entry Name
MAGAC_HUMAN

NCBI Description

This gene is closely related to several other genes clustered on chromosome X. These genes may be overexpressed in tumors. Multiple alternatively spliced variants encoding the same protein have been identified. [provided by RefSeq, Jun 2014]

Uniprot Description

MAGEA12: Not known, though may play a role tumor transformation or progression. In vitro promotes cell viability in melanoma cell lines.

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xq28

Research Articles on MAGEA12

Similar Products

Product Notes

The MAGEA12 magea12 (Catalog #AAA1273869) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccacttg agcagaggag tcagcactgc aagcctgagg aaggccttga ggcccaagga gaggccctgg gcttggtggg tgcgcaggct cctgctactg aggagcagga gactgcctcc tcctcctcta ctctagtgga agtcaccctg cgggaggtgc ctgctgccga gtcaccaagt cctccccaca gtcctcaggg agcctccacc ctccccacta ccatcaacta tactctctgg agtcaatccg atgagggctc cagcaacgaa gaacaggaag ggccaagcac ctttcctgac ctggagacga gcttccaagt agcactcagt aggaagatgg ctgagttggt tcattttctg ctcctcaagt atcgagccag ggagccattc acaaaggcag aaatgctggg gagtgtcatc agaaatttcc aggacttctt tcctgtgatc ttcagcaaag cctccgagta cttgcagctg gtctttggca tcgaggtggt ggaagtggtc cgcatcggcc acttgtacat ccttgtcacc tgcctgggcc tctcctacga tggcctgctg ggcgacaatc agatcgtgcc caagacaggc ctcctgataa tcgtcctggc cataatcgca aaagagggcg actgtgcccc tgaggagaaa atctgggagg agctgagtgt gttggaggca tctgatggga gggaggacag tgtctttgcg catcccagga agctgctcac ccaagatttg gtgcaggaaa actacctgga gtaccggcag gtccccggca gtgatcctgc atgctacgag ttcctgtggg gtccaagggc cctcgttgaa accagctatg tgaaagtcct gcaccatttg ctaaagatca gtggaggacc tcacatttcc tacccacccc tgcatgaatg ggcttttaga gagggggaag agtga. It is sometimes possible for the material contained within the vial of "MAGEA12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.