Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LSM10 cdna clone

LSM10 cDNA Clone

Gene Names
LSM10; MST074; MSTP074
Synonyms
LSM10; LSM10 cDNA Clone; LSM10 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtgagccattcagtgaaggagcggaccatctctgagaacagcctgatcatcctactgcagggcctccagggccgggtaaccactgtggacctgcgggatgagagcgtggcccacggacgcatagacaatgtcgatgctttcatgaacatccgcctggccaaagtcacctacacggaccgttgggggcatcaggtcaagctggatgacctctttgtgacaggccgcaatgtccgctacgtccacatcccagatgacgtgaacatcacctcgaccattgagcagcagctgcagattatccatcgggtgcgaaactttggtggcaagggccaaggccggtgggaatttcccccaaaaaactgtaagtga
Sequence Length
372
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,080 Da
NCBI Official Full Name
Homo sapiens LSM10, U7 small nuclear RNA associated, mRNA
NCBI Official Synonym Full Names
LSM10, U7 small nuclear RNA associated
NCBI Official Symbol
LSM10
NCBI Official Synonym Symbols
MST074; MSTP074
NCBI Protein Information
U7 snRNA-associated Sm-like protein LSm10
UniProt Protein Name
U7 snRNA-associated Sm-like protein LSm10
UniProt Gene Name
LSM10
UniProt Entry Name
LSM10_HUMAN

Uniprot Description

LSM10: Appears to function in the U7 snRNP complex that is involved in histone 3'-end processing. Increases U7 snRNA levels but not histone 3'-end pre-mRNA processing activity, when overexpressed. Required for cell cycle progression from G1 to S phases. Binds specifically to U7 snRNA. Binds to the downstream cleavage product (DCP) of histone pre-mRNA in a U7 snRNP dependent manner. Belongs to the snRNP Sm proteins family.

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: Cajal body; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: histone mRNA metabolic process; termination of RNA polymerase II transcription

Research Articles on LSM10

Similar Products

Product Notes

The LSM10 lsm10 (Catalog #AAA1273524) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtga gccattcagt gaaggagcgg accatctctg agaacagcct gatcatccta ctgcagggcc tccagggccg ggtaaccact gtggacctgc gggatgagag cgtggcccac ggacgcatag acaatgtcga tgctttcatg aacatccgcc tggccaaagt cacctacacg gaccgttggg ggcatcaggt caagctggat gacctctttg tgacaggccg caatgtccgc tacgtccaca tcccagatga cgtgaacatc acctcgacca ttgagcagca gctgcagatt atccatcggg tgcgaaactt tggtggcaag ggccaaggcc ggtgggaatt tcccccaaaa aactgtaagt ga. It is sometimes possible for the material contained within the vial of "LSM10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.