Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LMBRD1 cdna clone

LMBRD1 cDNA Clone

Gene Names
LMBRD1; NESI; LMBD1; MAHCF; C6orf209
Synonyms
LMBRD1; LMBRD1 cDNA Clone; LMBRD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttggcagctataacttacacagcctatggcatgtctgcgttacctttaaatctgataaaaggcactagaagcgctgcttatgaacgtttggaaaacactgaagacattgaagaagtagaacaacacattcaaacgattaaatcaaaaagcaaagatggtcgacctttgccagcaagggataaacgcgccttaaaacaatttgaagaaaggttacgaacacttaagaagagagagaggcatttagaattcattgaaaacagctggtggacaaaattttgtggcgctctgcgtcccctgaagatcgtctggggaatatttttcatcttagttgcattgctgtttgtaatttctctcttcttgtcaaatttagataaagctcttcattcagctggaatagattctggtttcataatttttggagctaacctgagtaatccactgaatatgcttttgcctttactacaaacagaattcgaaatattggcatatggttcttttggattagattatataaaatcagaagaggtagaaccaggccccaagcactcctttttctctgcatga
Sequence Length
567
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,394 Da
NCBI Official Full Name
Homo sapiens LMBR1 domain containing 1, mRNA
NCBI Official Synonym Full Names
LMBR1 domain containing 1
NCBI Official Symbol
LMBRD1
NCBI Official Synonym Symbols
NESI; LMBD1; MAHCF; C6orf209
NCBI Protein Information
probable lysosomal cobalamin transporter
UniProt Protein Name
Probable lysosomal cobalamin transporter
UniProt Gene Name
LMBRD1
UniProt Synonym Gene Names
C6orf209; NESI
UniProt Entry Name
LMBD1_HUMAN

NCBI Description

This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]

Uniprot Description

LMBRD1: Probable lysosomal cobalamin transporter. Required to export cobalamin from lysosomes allowing its conversion to cofactors. Isoform 3 may play a role in the assembly of hepatitis delta virus (HDV). Defects in LMBRD1 are the cause of methylmalonic aciduria and homocystinuria type cblF (MMAHCF). A disorder of cobalamin metabolism characterized by decreased levels of the coenzymes adenosylcobalamin (AdoCbl) and methylcobalamin (MeCbl). It is due to accumulation of free cobalamin in lysosomes, thus hindering its conversion to cofactors. Clinical features include developmental delay, stomatitis, glossitis, seizures and methylmalonic aciduria responsive to vitamin B12. Belongs to the LIMR family. LMBRD1 subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 6q13

Cellular Component: lysosomal membrane; membrane

Molecular Function: cobalamin transporter activity

Biological Process: cobalamin metabolic process

Disease: Methylmalonic Aciduria And Homocystinuria, Cblf Type

Research Articles on LMBRD1

Similar Products

Product Notes

The LMBRD1 lmbrd1 (Catalog #AAA1274470) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggcag ctataactta cacagcctat ggcatgtctg cgttaccttt aaatctgata aaaggcacta gaagcgctgc ttatgaacgt ttggaaaaca ctgaagacat tgaagaagta gaacaacaca ttcaaacgat taaatcaaaa agcaaagatg gtcgaccttt gccagcaagg gataaacgcg ccttaaaaca atttgaagaa aggttacgaa cacttaagaa gagagagagg catttagaat tcattgaaaa cagctggtgg acaaaatttt gtggcgctct gcgtcccctg aagatcgtct ggggaatatt tttcatctta gttgcattgc tgtttgtaat ttctctcttc ttgtcaaatt tagataaagc tcttcattca gctggaatag attctggttt cataattttt ggagctaacc tgagtaatcc actgaatatg cttttgcctt tactacaaac agaattcgaa atattggcat atggttcttt tggattagat tatataaaat cagaagaggt agaaccaggc cccaagcact cctttttctc tgcatga. It is sometimes possible for the material contained within the vial of "LMBRD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.