Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

LIN7A cdna clone

LIN7A cDNA Clone

Gene Names
LIN7A; LIN7; VELI1; LIN-7A; MALS-1; TIP-33
Synonyms
LIN7A; LIN7A cDNA Clone; LIN7A cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
ATGCTGAAGCCGAGCGTCACTTCGGCTCCCACGGCAGACATGGCGACATTGACAGTGGTCCAGCCGCTCACCCTGGACAGAGATGTTGCAAGAGCAATTGAATTACTGGAAAAACTACAGGAATCTGGAGAAGTACCAGTGCACAAGCTACAATCCCTCAAAAAAGTGCTTCAGAGTGAGTTTTGTACAGCTATTCGAGAGGTGTATCAATATATGCATGAAACGATAACTGTTAATGGCTGTCCCGAATTCCGTGCGAGGGCAACAGCAAAGGCAACAGTTGCAGCTTTTGCAGCTAGTGAAGGCCACTCCCACCCTCGAGTAGTTGAACTGCCAAAGACTGATGAAGGCCTTGGTTTTAATGTGATGGGAGGAAAGGAGCAAAATTCCCCCATTTATATCTCTCGCATAATTCCTGGAGGGGTGGCTGAAAGACACGGAGGCCTCAAAAGAGGAGACCAGCTGCTATCAGTGAACGGAGTGAGTGTGGAAGGAGAACACCATGAGAAAGCTGTGGAACTACTCAAGGCTGCTAAAGACAGCGTCAAGCTGGTGGTGCGATACACCCCAAAAGTTCTGGAAGAAATGGAGGCTCGCTTTGAAAAGCTACGAACAGCCAGGCGTCGGCAGCAGCAGCAATTGCTAATTCAGCAGCAGCAACAGCAGCAGCAGCAACAAACACAACAAAACCACATGTCATAG
Sequence Length
702
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,997 Da
NCBI Official Full Name
Homo sapiens lin-7 homolog A (C. elegans), mRNA
NCBI Official Synonym Full Names
lin-7 homolog A, crumbs cell polarity complex component
NCBI Official Symbol
LIN7A
NCBI Official Synonym Symbols
LIN7; VELI1; LIN-7A; MALS-1; TIP-33
NCBI Protein Information
protein lin-7 homolog A
UniProt Protein Name
Protein lin-7 homolog A
Protein Family
UniProt Gene Name
LIN7A
UniProt Synonym Gene Names
MALS1; VELI1; Lin-7A; hLin-7; MALS-1; TIP-33; Veli-1
UniProt Entry Name
LIN7A_HUMAN

NCBI Description

The protein encoded by this gene is involved in generating and maintaining the asymmetric distribution of channels and receptors at the cell membrane. The encoded protein also is required for the localization of some specific channels and can be part of a protein complex that couples synaptic vesicle exocytosis to cell adhesion in the brain. [provided by RefSeq, May 2016]

Uniprot Description

LIN7A: Plays a role in establishing and maintaining the asymmetric distribution of channels and receptors at the plasma membrane of polarized cells. Forms membrane-associated multiprotein complexes that may regulate delivery and recycling of proteins to the correct membrane domains. The tripartite complex composed of LIN7 (LIN7A, LIN7B or LIN7C), CASK and APBA1 may have the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Ensures the proper localization of GRIN2B (subunit 2B of the NMDA receptor) to neuronal postsynaptic density and may function in localizing synaptic vesicles at synapses where it is recruited by beta-catenin and cadherin. Required to localize Kir2 channels, GABA transporter (SLC6A12) and EGFR/ERBB1, ERBB2, ERBB3 and ERBB4 to the basolateral membrane of epithelial cells. Belongs to the lin-7 family.

Protein type: Adaptor/scaffold; Cell adhesion

Chromosomal Location of Human Ortholog: 12q21

Cellular Component: basolateral plasma membrane; intercellular junction; plasma membrane

Molecular Function: protein binding

Biological Process: maintenance of epithelial cell polarity; neurotransmitter secretion; protein complex assembly

Research Articles on LIN7A

Similar Products

Product Notes

The LIN7A lin7a (Catalog #AAA1274561) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCTGAAGC CGAGCGTCAC TTCGGCTCCC ACGGCAGACA TGGCGACATT GACAGTGGTC CAGCCGCTCA CCCTGGACAG AGATGTTGCA AGAGCAATTG AATTACTGGA AAAACTACAG GAATCTGGAG AAGTACCAGT GCACAAGCTA CAATCCCTCA AAAAAGTGCT TCAGAGTGAG TTTTGTACAG CTATTCGAGA GGTGTATCAA TATATGCATG AAACGATAAC TGTTAATGGC TGTCCCGAAT TCCGTGCGAG GGCAACAGCA AAGGCAACAG TTGCAGCTTT TGCAGCTAGT GAAGGCCACT CCCACCCTCG AGTAGTTGAA CTGCCAAAGA CTGATGAAGG CCTTGGTTTT AATGTGATGG GAGGAAAGGA GCAAAATTCC CCCATTTATA TCTCTCGCAT AATTCCTGGA GGGGTGGCTG AAAGACACGG AGGCCTCAAA AGAGGAGACC AGCTGCTATC AGTGAACGGA GTGAGTGTGG AAGGAGAACA CCATGAGAAA GCTGTGGAAC TACTCAAGGC TGCTAAAGAC AGCGTCAAGC TGGTGGTGCG ATACACCCCA AAAGTTCTGG AAGAAATGGA GGCTCGCTTT GAAAAGCTAC GAACAGCCAG GCGTCGGCAG CAGCAGCAAT TGCTAATTCA GCAGCAGCAA CAGCAGCAGC AGCAACAAAC ACAACAAAAC CACATGTCAT AG. It is sometimes possible for the material contained within the vial of "LIN7A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual