Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HOMER3 cdna clone

HOMER3 cDNA Clone

Gene Names
HOMER3; VESL3; HOMER-3
Synonyms
HOMER3; HOMER3 cDNA Clone; HOMER3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccacagccagggagcagccaatcttcagcacacgggcgcacgtgttccaaattgacccagccaccaagcgaaactggatcccagcgggcaagcacgcactcactgtctcctatttctacgatgccacccgcaatgtgtaccgcatcatcagcatcggaggcgccaaggccatcatcaacagcactgtcactcccaacatgaccttcaccaaaacttcccagaagttcgggcagtgggccgacagtcgcgccaacacagtctacggcttgggctttgcctctgaacagcatctgacacagtttgccgagaagttccaggaagtgaaggaagcagccaggctggccagggagaaatctcaggatggcggggagctcaccagtccagccctggggctcgcctcccaccaggtgcccccgagccctctcgtcagtgccaacggccccggcgaggaaaaactgttccgcagccagagcgctgatgcccccggccccacagagcgcgagcggctaaagaagatgttgtctgagggctccgtgggcgaggtacagtgggaggccgagtttttcgcactgcaggacagcaacaacaagctggcaggcgccctgcgagaggccaacgccgccgcagcccagtggaggcagcagctggaggctcagcgtgcagaggccgagcggctgcggcagcgggtggctgagctggaggctcaggcagcttcagaggtgacccccaccggtgagaaggaggggctgggccagggccagtcgctggaacagctggaagctctggtgcaaaccaaggaccaggagattcagaccctgaagagtcagactggggggccccgcgaggccctggaggctgccgagcgtgaggagactcagcagaaggtgcaggacctggagacccgcaatgcggagttggagcaccagctgcgggcgatggagcgcagcctggaggaggcacgggcagagcgggagcgggcgcgggctgaggtgggccgggcagcgcagctgctggacgtcaggctgtttgagctgagtgagctgcgtgagggcctggcccgcctggctgaggctgcgccctga
Sequence Length
1086
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,954 Da
NCBI Official Full Name
Homo sapiens homer homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
homer scaffolding protein 3
NCBI Official Symbol
HOMER3
NCBI Official Synonym Symbols
VESL3; HOMER-3
NCBI Protein Information
homer protein homolog 3
UniProt Protein Name
Homer protein homolog 3
Protein Family
UniProt Gene Name
HOMER3
UniProt Synonym Gene Names
Homer-3
UniProt Entry Name
HOME3_HUMAN

NCBI Description

This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]

Uniprot Description

HOMER3: Postsynaptic density scaffolding protein. Binds and cross-links cytoplasmic regions of GRM1, GRM5, ITPR1, DNM3, RYR1, RYR2, SHANK1 and SHANK3. By physically linking GRM1 and GRM5 with ER-associated ITPR1 receptors, it aids the coupling of surface receptors to intracellular calcium release. Isoforms can be differently regulated and may play an important role in maintaining the plasticity at glutamatergic synapses. Belongs to the Homer family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 19p13.11

Cellular Component: cytoplasm; plasma membrane

Molecular Function: metabotropic glutatmate receptor binding; protein binding

Biological Process: metabotropic glutamate receptor signaling pathway; protein targeting

Research Articles on HOMER3

Similar Products

Product Notes

The HOMER3 homer3 (Catalog #AAA1270663) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccacag ccagggagca gccaatcttc agcacacggg cgcacgtgtt ccaaattgac ccagccacca agcgaaactg gatcccagcg ggcaagcacg cactcactgt ctcctatttc tacgatgcca cccgcaatgt gtaccgcatc atcagcatcg gaggcgccaa ggccatcatc aacagcactg tcactcccaa catgaccttc accaaaactt cccagaagtt cgggcagtgg gccgacagtc gcgccaacac agtctacggc ttgggctttg cctctgaaca gcatctgaca cagtttgccg agaagttcca ggaagtgaag gaagcagcca ggctggccag ggagaaatct caggatggcg gggagctcac cagtccagcc ctggggctcg cctcccacca ggtgcccccg agccctctcg tcagtgccaa cggccccggc gaggaaaaac tgttccgcag ccagagcgct gatgcccccg gccccacaga gcgcgagcgg ctaaagaaga tgttgtctga gggctccgtg ggcgaggtac agtgggaggc cgagtttttc gcactgcagg acagcaacaa caagctggca ggcgccctgc gagaggccaa cgccgccgca gcccagtgga ggcagcagct ggaggctcag cgtgcagagg ccgagcggct gcggcagcgg gtggctgagc tggaggctca ggcagcttca gaggtgaccc ccaccggtga gaaggagggg ctgggccagg gccagtcgct ggaacagctg gaagctctgg tgcaaaccaa ggaccaggag attcagaccc tgaagagtca gactgggggg ccccgcgagg ccctggaggc tgccgagcgt gaggagactc agcagaaggt gcaggacctg gagacccgca atgcggagtt ggagcaccag ctgcgggcga tggagcgcag cctggaggag gcacgggcag agcgggagcg ggcgcgggct gaggtgggcc gggcagcgca gctgctggac gtcaggctgt ttgagctgag tgagctgcgt gagggcctgg cccgcctggc tgaggctgcg ccctga. It is sometimes possible for the material contained within the vial of "HOMER3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.