Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GDI2 cdna clone

GDI2 cDNA Clone

Gene Names
GDI2; RABGDIB; HEL-S-46e
Synonyms
GDI2; GDI2 cDNA Clone; GDI2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgaggagtacgacgtgatcgtgctgggcaccggcctgacggaatgtatcctgtcaggtataatgtcagtgaatggcaagaaagttcttcatatggatcgaaacccttactacggaggagagagtgcatctataacaccattggaagatttatacaaaagatttaaaataccaggatcaccacccgagtcaatggggagaggaagagactggaatgttgacttgattcccaagttccttatggctaatggtcagctggttaagatgctgctttatacagaggtaactcgctatctggattttaaagtgactgaagggagctttgtctataagggtggaaaaatctacaaggttccttccactgaagcagaagccctggcatctagcctaatgggattgtttgaaaaacgtcgcttcaggaaattcctagtgtatgttgccaacttcgatgaaaaagatccaagaacttttgaaggcattgatcctaagaagaccacaatgcgagatgtgtataagaaatttgatttgggtcaagacgttatagattttactggtcatgctcttgcactttacagaactgatgattacttagatcaaccgtgttatgaaaccattaatagaattaaactttacagtgaatctttggcaagatatggcaaaagcccatacctttatccactctatggccttggagaactgccccaaggatttgcaaggctaagtgctatttatggaggtacctatatgctgaataaacccattgaagaaatcattgtacagaatggaaaagtaattggtgtaaaatctgaaggagaaattgctcgctgtaagcagctcatctgtgaccccagctacgtaaaagatcgggtagaaaaagtgggccaggtgatcagagttatttgcatcctcagccaccccatcaagaacaccaatgatgccaactcctgccagatcattattccacagaaccaagtcaatcgaaagtcagatatctacgtctgcatgatctcctttgcgcacaatgtagcagcacaagggaagtacattgctatagttagtacaactgtggaaaccaaggagcctgagaaggaaatcagaccagctttggagctcttggaaccaattgaacagaaatttgttagcatcagtgacctcctggtaccaaaagacttgggaacagaaagccagatctttatttcccgcacatatgatgccaccactcattttgagacaacgtgtgatgacattaaaaacatctataagaggatgacaggatcagagtttgactttgaggaaatgaagcgcaagaagaatgacatctatggggaagactaa
Sequence Length
1338
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,619 Da
NCBI Official Full Name
Homo sapiens GDP dissociation inhibitor 2, mRNA
NCBI Official Synonym Full Names
GDP dissociation inhibitor 2
NCBI Official Symbol
GDI2
NCBI Official Synonym Symbols
RABGDIB; HEL-S-46e
NCBI Protein Information
rab GDP dissociation inhibitor beta
UniProt Protein Name
Rab GDP dissociation inhibitor beta
UniProt Gene Name
GDI2
UniProt Synonym Gene Names
RABGDIB; Rab GDI beta; GDI-2
UniProt Entry Name
GDIB_HUMAN

NCBI Description

GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

GDI2: Regulates the GDP/GTP exchange reaction of most Rab proteins by inhibiting the dissociation of GDP from them, and the subsequent binding of GTP to them. Belongs to the Rab GDI family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; G protein regulator, misc.

Chromosomal Location of Human Ortholog: 10p15

Cellular Component: cytoplasm; cytosol; focal adhesion; vesicle

Molecular Function: protein binding

Biological Process: regulation of small GTPase mediated signal transduction; signal transduction

Research Articles on GDI2

Similar Products

Product Notes

The GDI2 gdi2 (Catalog #AAA1274882) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgagg agtacgacgt gatcgtgctg ggcaccggcc tgacggaatg tatcctgtca ggtataatgt cagtgaatgg caagaaagtt cttcatatgg atcgaaaccc ttactacgga ggagagagtg catctataac accattggaa gatttataca aaagatttaa aataccagga tcaccacccg agtcaatggg gagaggaaga gactggaatg ttgacttgat tcccaagttc cttatggcta atggtcagct ggttaagatg ctgctttata cagaggtaac tcgctatctg gattttaaag tgactgaagg gagctttgtc tataagggtg gaaaaatcta caaggttcct tccactgaag cagaagccct ggcatctagc ctaatgggat tgtttgaaaa acgtcgcttc aggaaattcc tagtgtatgt tgccaacttc gatgaaaaag atccaagaac ttttgaaggc attgatccta agaagaccac aatgcgagat gtgtataaga aatttgattt gggtcaagac gttatagatt ttactggtca tgctcttgca ctttacagaa ctgatgatta cttagatcaa ccgtgttatg aaaccattaa tagaattaaa ctttacagtg aatctttggc aagatatggc aaaagcccat acctttatcc actctatggc cttggagaac tgccccaagg atttgcaagg ctaagtgcta tttatggagg tacctatatg ctgaataaac ccattgaaga aatcattgta cagaatggaa aagtaattgg tgtaaaatct gaaggagaaa ttgctcgctg taagcagctc atctgtgacc ccagctacgt aaaagatcgg gtagaaaaag tgggccaggt gatcagagtt atttgcatcc tcagccaccc catcaagaac accaatgatg ccaactcctg ccagatcatt attccacaga accaagtcaa tcgaaagtca gatatctacg tctgcatgat ctcctttgcg cacaatgtag cagcacaagg gaagtacatt gctatagtta gtacaactgt ggaaaccaag gagcctgaga aggaaatcag accagctttg gagctcttgg aaccaattga acagaaattt gttagcatca gtgacctcct ggtaccaaaa gacttgggaa cagaaagcca gatctttatt tcccgcacat atgatgccac cactcatttt gagacaacgt gtgatgacat taaaaacatc tataagagga tgacaggatc agagtttgac tttgaggaaa tgaagcgcaa gaagaatgac atctatgggg aagactaa. It is sometimes possible for the material contained within the vial of "GDI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.