Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCET2 cdna clone

GCET2 cDNA Clone

Gene Names
GCSAM; HGAL; GCAT2; GCET2
Synonyms
GCET2; GCET2 cDNA Clone; GCET2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaaattctctgctgagagaaaacaggcggcagcagaacactcaagagatgccttggaatgtgagaatgcaaagccccaaacagagaacatccagatgctgggatcaccatatcgctgaagggtgtttctgccttccatggaaaaaaatactcatttttgaaaagaggcaagattcccaaaacgaaaatgaaagaatgtcatctactcccatccaggacaatgttgaccagacctactcagaggagctgtgctataccctcatcaatcatcgggttctctgtacaaggccatcagggaactctgctgaagagtactatgagaatgttccctgcaaagctgagagacccagagagtccttgggaggaactgagactgagtattcacttctacatatgccttctacagaccccaggcatgcccgatccccagaagatgaatatgaacttctcatgcctcacagaatctcctctcactttctgcaacagccacgtccacttatggccccttctgagactcagttttcccatttatag
Sequence Length
537
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,206 Da
NCBI Official Full Name
Homo sapiens germinal center expressed transcript 2, mRNA
NCBI Official Synonym Full Names
germinal center associated signaling and motility
NCBI Official Symbol
GCSAM
NCBI Official Synonym Symbols
HGAL; GCAT2; GCET2
NCBI Protein Information
germinal center-associated signaling and motility protein
UniProt Protein Name
Germinal center-associated signaling and motility protein
UniProt Gene Name
GCSAM
UniProt Synonym Gene Names
GAL; GCET2; hGAL
UniProt Entry Name
GCSAM_HUMAN

NCBI Description

This gene encodes a protein which may function in signal transduction pathways and whose expression is elevated in germinal cell lymphomas. It contains a putative PDZ-interacting domain, an immunoreceptor tyrosine-based activation motif (ITAM), and two putative SH2 binding sites. In B cells, its expression is specifically induced by interleukin-4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

GCET2: a protein expressed in normal germinal center B cells, immature B and T cells. Induced by IL4. Its expression strongly predicts survival in diffuse large B-cell lymphoma.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 3q13.2

Molecular Function: actin binding; myosin II binding; protein binding; protein kinase binding

Biological Process: regulation of B cell receptor signaling pathway

Research Articles on GCET2

Similar Products

Product Notes

The GCET2 gcsam (Catalog #AAA1271331) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaaatt ctctgctgag agaaaacagg cggcagcaga acactcaaga gatgccttgg aatgtgagaa tgcaaagccc caaacagaga acatccagat gctgggatca ccatatcgct gaagggtgtt tctgccttcc atggaaaaaa atactcattt ttgaaaagag gcaagattcc caaaacgaaa atgaaagaat gtcatctact cccatccagg acaatgttga ccagacctac tcagaggagc tgtgctatac cctcatcaat catcgggttc tctgtacaag gccatcaggg aactctgctg aagagtacta tgagaatgtt ccctgcaaag ctgagagacc cagagagtcc ttgggaggaa ctgagactga gtattcactt ctacatatgc cttctacaga ccccaggcat gcccgatccc cagaagatga atatgaactt ctcatgcctc acagaatctc ctctcacttt ctgcaacagc cacgtccact tatggcccct tctgagactc agttttccca tttatag. It is sometimes possible for the material contained within the vial of "GCET2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.