Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAP cdna clone

FAP cDNA Clone

Gene Names
FAP; FAPA; SIMP; DPPIV
Synonyms
FAP; FAP cDNA Clone; FAP cdna clone
Ordering
For Research Use Only!
Sequence
atgaagacttgggtaaaaatcgtatttggagttgccacctctgctgtgcttgccttattggtgatgtgcattgtcttacgcccttcaagagttcataactctgaagaaaatacaatgagagcactcacactgaaggatattttaaatggaacattttcttataaaacattttttccaaactggatttcaggacaagaatatcttcatcaatctgcagataacaatatagtactttataatattgaaacaggacaatcatataccattttgagtaatagaaccatgaaaagtgtgaatgcttcaaattacggcttatcacctgatcggcaatttgtatatctagaaagtgattattcaaagctttggagatactcttacacagcaacatattacatctatgaccttagcaatggagaatttgtaagaggaaatgagcttcctcgtccaattcagtatttatgctggtcgcctgttgggagtaaattagcatatgtctatcaaaacaatatctatttgaaacaaagaccaggagatccaccttttcaaataacatttaatggaagagaaaataaaatatttaatggaatcccagactgggtttatgaagaggaaatgcttgctacaaaatatgctctctggtggtctcctaatggaaaatttttggcatatgcggaatttaatgatacggatataccagttattgcctattcctattatggcgatgaacaatatcctagaacaataaatattccatacccaaaggctggagctaagaatcccgttgttcggatatttattatcgataccacttaccctgcgtatgtaggtccccaggaagtgcctgttccagcaatgatagcctcaagtgattattatttcagttggctcacgtgggttactgatgaacgagtatgtttgcagtggctaaaaagagtccagaatgtttcggtcctgtctatatgtgacttcagggaagactggcagacatgggattgtccaaagacccaggagcatatagaagaaagcagaactggatgggctggtggattctttgtttcaacaccagttttcagctatgatgccatttcgtactacaaaatatttagtgacaaggatggctacaaacatattcactatatcaaagacactgtggaaaatgctattcaaattacaagtggcaagtgggaggccataaatatattcagagtaacacaggattcactgttttattctagcaatgaatttgaagaataccctggaagaagaaacatctacagaattagcattggaagctatcctccaagcaagaagtgtgttacttgccatctaaggaaagaaaggtgccaatattacacagcaagtttcagcgactacgccaagtactatgcacttgtctgctacggcccaggcatccccatttccacccttcatgatggacgcactgatcaagaaattaaaatcctggaagaaaacaaggaattggaaaatgctttgaaaaatatccagctgcctaaagaggaaattaagaaacttgaagtagatgaaattactttatggtacaagatgattcttcctcctcaatttgacagatcaaagaagtatcccttgctaattcaagtgtatggtggtccctgcagtcagagtgtaaggtctgtatttgctgttaattggatatcttatcttgcaagtaaggaagggatggtcattgccttggtggatggtcgaggaacagctttccaaggtgacaaactcctctatgcagtgtatcgaaagctgggtgtttatgaagttgaagaccagattacagctgtcagaaaattcatagaaatgggtttcattgatgaaaaaagaatagccatatggggctggtcctatggaggatacgtttcatcactggcccttgcatctggaactggtcttttcaaatgtggtatagcagtggctccagtctccagctgggaatattacgcgtctgtctacacagagagattcatgggtctcccaacaaaggatgataatcttgagcactataagaattcaactgtgatggcaagagcagaatatttcagaaatgtagactatcttctcatccacggaacagcagatgataatgtgcactttcaaaactcagcacagattgctaaagctctggttaatgcacaagtggatttccaggcaatgtggtactctgaccagaaccacggcttatccggcctgtccacgaaccacttatacacccacatgacccacttcctaaagcagtgtttctctttgtcagactaa
Sequence Length
2283
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,954 Da
NCBI Official Full Name
Homo sapiens fibroblast activation protein, alpha, mRNA
NCBI Official Synonym Full Names
fibroblast activation protein alpha
NCBI Official Symbol
FAP
NCBI Official Synonym Symbols
FAPA; SIMP; DPPIV
NCBI Protein Information
prolyl endopeptidase FAP
UniProt Protein Name
Prolyl endopeptidase FAP
Protein Family
UniProt Gene Name
FAP
UniProt Synonym Gene Names
APCE
UniProt Entry Name
SEPR_HUMAN

NCBI Description

The protein encoded by this gene is a homodimeric integral membrane gelatinase belonging to the serine protease family. It is selectively expressed in reactive stromal fibroblasts of epithelial cancers, granulation tissue of healing wounds, and malignant cells of bone and soft tissue sarcomas. This protein is thought to be involved in the control of fibroblast growth or epithelial-mesenchymal interactions during development, tissue repair, and epithelial carcinogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]

Uniprot Description

FAP: In association with DPP4 is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. May have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers. Belongs to the peptidase S9B family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.14.5; EC 3.4.21.26; Membrane protein, integral; Protease

Chromosomal Location of Human Ortholog: 2q23

Cellular Component: cell surface; extracellular space; focal adhesion; lamellipodium; plasma membrane

Molecular Function: dipeptidyl-peptidase activity; endopeptidase activity; integrin binding; metalloendopeptidase activity; peptidase activity; protease binding; protein binding; protein homodimerization activity; serine-type endopeptidase activity; serine-type peptidase activity

Biological Process: endothelial cell migration; proteolysis; proteolysis involved in cellular protein catabolic process; regulation of fibrinolysis

Research Articles on FAP

Similar Products

Product Notes

The FAP fap (Catalog #AAA1275553) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagactt gggtaaaaat cgtatttgga gttgccacct ctgctgtgct tgccttattg gtgatgtgca ttgtcttacg cccttcaaga gttcataact ctgaagaaaa tacaatgaga gcactcacac tgaaggatat tttaaatgga acattttctt ataaaacatt ttttccaaac tggatttcag gacaagaata tcttcatcaa tctgcagata acaatatagt actttataat attgaaacag gacaatcata taccattttg agtaatagaa ccatgaaaag tgtgaatgct tcaaattacg gcttatcacc tgatcggcaa tttgtatatc tagaaagtga ttattcaaag ctttggagat actcttacac agcaacatat tacatctatg accttagcaa tggagaattt gtaagaggaa atgagcttcc tcgtccaatt cagtatttat gctggtcgcc tgttgggagt aaattagcat atgtctatca aaacaatatc tatttgaaac aaagaccagg agatccacct tttcaaataa catttaatgg aagagaaaat aaaatattta atggaatccc agactgggtt tatgaagagg aaatgcttgc tacaaaatat gctctctggt ggtctcctaa tggaaaattt ttggcatatg cggaatttaa tgatacggat ataccagtta ttgcctattc ctattatggc gatgaacaat atcctagaac aataaatatt ccatacccaa aggctggagc taagaatccc gttgttcgga tatttattat cgataccact taccctgcgt atgtaggtcc ccaggaagtg cctgttccag caatgatagc ctcaagtgat tattatttca gttggctcac gtgggttact gatgaacgag tatgtttgca gtggctaaaa agagtccaga atgtttcggt cctgtctata tgtgacttca gggaagactg gcagacatgg gattgtccaa agacccagga gcatatagaa gaaagcagaa ctggatgggc tggtggattc tttgtttcaa caccagtttt cagctatgat gccatttcgt actacaaaat atttagtgac aaggatggct acaaacatat tcactatatc aaagacactg tggaaaatgc tattcaaatt acaagtggca agtgggaggc cataaatata ttcagagtaa cacaggattc actgttttat tctagcaatg aatttgaaga ataccctgga agaagaaaca tctacagaat tagcattgga agctatcctc caagcaagaa gtgtgttact tgccatctaa ggaaagaaag gtgccaatat tacacagcaa gtttcagcga ctacgccaag tactatgcac ttgtctgcta cggcccaggc atccccattt ccacccttca tgatggacgc actgatcaag aaattaaaat cctggaagaa aacaaggaat tggaaaatgc tttgaaaaat atccagctgc ctaaagagga aattaagaaa cttgaagtag atgaaattac tttatggtac aagatgattc ttcctcctca atttgacaga tcaaagaagt atcccttgct aattcaagtg tatggtggtc cctgcagtca gagtgtaagg tctgtatttg ctgttaattg gatatcttat cttgcaagta aggaagggat ggtcattgcc ttggtggatg gtcgaggaac agctttccaa ggtgacaaac tcctctatgc agtgtatcga aagctgggtg tttatgaagt tgaagaccag attacagctg tcagaaaatt catagaaatg ggtttcattg atgaaaaaag aatagccata tggggctggt cctatggagg atacgtttca tcactggccc ttgcatctgg aactggtctt ttcaaatgtg gtatagcagt ggctccagtc tccagctggg aatattacgc gtctgtctac acagagagat tcatgggtct cccaacaaag gatgataatc ttgagcacta taagaattca actgtgatgg caagagcaga atatttcaga aatgtagact atcttctcat ccacggaaca gcagatgata atgtgcactt tcaaaactca gcacagattg ctaaagctct ggttaatgca caagtggatt tccaggcaat gtggtactct gaccagaacc acggcttatc cggcctgtcc acgaaccact tatacaccca catgacccac ttcctaaagc agtgtttctc tttgtcagac taa. It is sometimes possible for the material contained within the vial of "FAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.