Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERP27 cdna clone

ERP27 cDNA Clone

Gene Names
ERP27; PDIA8; C12orf46
Synonyms
ERP27; ERP27 cDNA Clone; ERP27 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagctgccccgtccaggttcatgttcctcttatttctcctcacgtgtgagctggctgcagaagttgctgcagaagttgagaaatcctcagatggtcctggtgctgcccaggaacccacgtggctcacagatgtcccagctgccatggaattcattgctgccactgaggtggctgtcataggcttcttccaggatttagaaataccagcagtgcccatactccatagcatggtgcaaaaattcccaggcgtgtcatttgggatcagcactgattctgaggttctgacacactacaacatcactgggaacaccatctgcctctttcgcctggtagacaatgaacaactgaatttagaggacgaagacattgaaagcattgatgccaccaaattgagccgtttcattgagatcaacagcctccacatggtgacagagtacaaccctgtgactgtgattgggttattcaacagcgtaattcagattcatctcctcctgataatgaacaaggcctccccagagtatgaagagaacatgcacagataccagaaggcagccaagctcttccaggggaagattctctttattctggtggacagtggtatgaaagaaaatgggaaggtgatatcatttttcaaactaaaggagtctcaactgccagctttggcaatttaccagactctagatgacgagtgggatacactgcccacagcagaagtttccgtagagcatgtgcaaaacttttgtgatggattcctaagtggaaaattgttgaaagaaaatcgtgaatcagaaggaaagactccaaaggtggaactctga
Sequence Length
822
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,480 Da
NCBI Official Full Name
Homo sapiens endoplasmic reticulum protein 27, mRNA
NCBI Official Synonym Full Names
endoplasmic reticulum protein 27
NCBI Official Symbol
ERP27
NCBI Official Synonym Symbols
PDIA8; C12orf46
NCBI Protein Information
endoplasmic reticulum resident protein 27
UniProt Protein Name
Endoplasmic reticulum resident protein 27
UniProt Gene Name
ERP27
UniProt Synonym Gene Names
C12orf46; ER protein 27; ERp27
UniProt Entry Name
ERP27_HUMAN

NCBI Description

ERP27 is a noncatalytic member of the protein disulfide isomerase (PDI; see MIM 608012) family of endoplasmic reticulum (ER) proteins (Alanen et al., 2006 [PubMed 16940051]).[supplied by OMIM, Mar 2008]

Uniprot Description

ERP27: Belongs to the protein disulfide isomerase family. Interacts with PDIA3. Binds somatostatin-14 via hydrophobic interactions

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 12p12.3

Cellular Component: endoplasmic reticulum

Molecular Function: protein binding; protein disulfide isomerase activity

Biological Process: protein folding

Research Articles on ERP27

Similar Products

Product Notes

The ERP27 erp27 (Catalog #AAA1274549) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagctg ccccgtccag gttcatgttc ctcttatttc tcctcacgtg tgagctggct gcagaagttg ctgcagaagt tgagaaatcc tcagatggtc ctggtgctgc ccaggaaccc acgtggctca cagatgtccc agctgccatg gaattcattg ctgccactga ggtggctgtc ataggcttct tccaggattt agaaatacca gcagtgccca tactccatag catggtgcaa aaattcccag gcgtgtcatt tgggatcagc actgattctg aggttctgac acactacaac atcactggga acaccatctg cctctttcgc ctggtagaca atgaacaact gaatttagag gacgaagaca ttgaaagcat tgatgccacc aaattgagcc gtttcattga gatcaacagc ctccacatgg tgacagagta caaccctgtg actgtgattg ggttattcaa cagcgtaatt cagattcatc tcctcctgat aatgaacaag gcctccccag agtatgaaga gaacatgcac agataccaga aggcagccaa gctcttccag gggaagattc tctttattct ggtggacagt ggtatgaaag aaaatgggaa ggtgatatca tttttcaaac taaaggagtc tcaactgcca gctttggcaa tttaccagac tctagatgac gagtgggata cactgcccac agcagaagtt tccgtagagc atgtgcaaaa cttttgtgat ggattcctaa gtggaaaatt gttgaaagaa aatcgtgaat cagaaggaaa gactccaaag gtggaactct ga. It is sometimes possible for the material contained within the vial of "ERP27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.