EIF3F cdna clone
EIF3F cDNA Clone
Gene Names
EIF3F; EIF3S5; eIF3-p47
Synonyms
EIF3F; EIF3F cDNA Clone; EIF3F cdna clone
Sequence
atggccacaccggcggtaccagtaagtgctcctccggccacgccaaccccagtcccggcggcggccccagcctcagttccagcgccaacgccagcaccggctgcggctccggttcccgctgcggctccagcctcatcctcagaccctgcggcagcagcggctgcaactgcggctcctggccagaccccggcctcagcgcaagctccagcgcagaccccagcgcccgctctgcctggtcctgctcttccagggcccttccccggcggccgcgtggtcaggctgcacccagtcattttggcctccattgtggacagctacgagagacgcaacgagggtgctgcccgagttatcgggaccctgttgggaactgtcgacaaacactcagtggaggtcaccaattgcttttcagtgccgcacaatgagtcagaagatgaagtggctgttgacatggaatttgctaagaatatgtatgaactgcataaaaaagtttctccaaatgagctcatcctgggctggtacgctacgggccatgacatcacagagcactctgtgctgatccatgagtactacagccgagaggcccccaaccccatccacctcactgtggacacaagtctccagaacggccgcatgagcatcaaagcctacgtcagcactttaatgggagtccctgggaggaccatgggagtgatgttcacgcctctgacagtgaaatacgcgtactacgacactgaacgcatcggagttgacctgatcatgaagacctgctttagccccaacagagtgattggactctcaagtgacttgcagcaagtaggaggggcatcagctcgcatccaggatgccctgagtacagtgttgcaatatgcagaggatgtactgtctggaaaggtgtcagctgacaatactgtgggccgcttcctgatgagcctggttaaccaagtaccgaaaatagttcccgatgactttgagaccatgctcaacagcaacatcaatgaccttttgatggtgacctacctggccaacctcacacagtcacagattgcactcaatgaaaaacttgtaaacctgtga
Sequence Length
1074
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,564 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 3, subunit F, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 3 subunit F
NCBI Official Symbol
EIF3F
NCBI Official Synonym Symbols
EIF3S5; eIF3-p47
NCBI Protein Information
eukaryotic translation initiation factor 3 subunit F
UniProt Protein Name
Eukaryotic translation initiation factor 3 subunit F
UniProt Gene Name
EIF3F
UniProt Synonym Gene Names
eIF3f
UniProt Entry Name
EIF3F_HUMAN
Uniprot Description
eIF3-epsilon: eukaryotic translation initiation factor 3, subunit 5 epsilon. Binds to the 40s ribosome and promotes the binding of methionyl-tRNAi and mRNA. Associates with the complex p170-eIF3. eIF-3 is composed of at least 12 different subunits.
Protein type: EC 3.4.19.12; Translation initiation; Translation
Chromosomal Location of Human Ortholog: 11p15.4
Cellular Component: cytosol; eukaryotic translation initiation factor 3 complex; membrane
Molecular Function: protein binding; translation initiation factor activity; translation initiation factor binding; ubiquitin-specific protease activity
Biological Process: protein deubiquitination; translational initiation
Research Articles on EIF3F
Similar Products
Product Notes
The EIF3F eif3f (Catalog #AAA1270269) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacac cggcggtacc agtaagtgct cctccggcca cgccaacccc agtcccggcg gcggccccag cctcagttcc agcgccaacg ccagcaccgg ctgcggctcc ggttcccgct gcggctccag cctcatcctc agaccctgcg gcagcagcgg ctgcaactgc ggctcctggc cagaccccgg cctcagcgca agctccagcg cagaccccag cgcccgctct gcctggtcct gctcttccag ggcccttccc cggcggccgc gtggtcaggc tgcacccagt cattttggcc tccattgtgg acagctacga gagacgcaac gagggtgctg cccgagttat cgggaccctg ttgggaactg tcgacaaaca ctcagtggag gtcaccaatt gcttttcagt gccgcacaat gagtcagaag atgaagtggc tgttgacatg gaatttgcta agaatatgta tgaactgcat aaaaaagttt ctccaaatga gctcatcctg ggctggtacg ctacgggcca tgacatcaca gagcactctg tgctgatcca tgagtactac agccgagagg cccccaaccc catccacctc actgtggaca caagtctcca gaacggccgc atgagcatca aagcctacgt cagcacttta atgggagtcc ctgggaggac catgggagtg atgttcacgc ctctgacagt gaaatacgcg tactacgaca ctgaacgcat cggagttgac ctgatcatga agacctgctt tagccccaac agagtgattg gactctcaag tgacttgcag caagtaggag gggcatcagc tcgcatccag gatgccctga gtacagtgtt gcaatatgca gaggatgtac tgtctggaaa ggtgtcagct gacaatactg tgggccgctt cctgatgagc ctggttaacc aagtaccgaa aatagttccc gatgactttg agaccatgct caacagcaac atcaatgacc ttttgatggt gacctacctg gccaacctca cacagtcaca gattgcactc aatgaaaaac ttgtaaacct gtga. It is sometimes possible for the material contained within the vial of "EIF3F, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
