Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EFCAB4B cdna clone

EFCAB4B cDNA Clone

Gene Names
CRACR2A; EFCAB4B
Synonyms
EFCAB4B; EFCAB4B cDNA Clone; EFCAB4B cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcccctgacgggagggtagtctccagaccccagagacttggtcaggggtctggccaggggccaaaggggagtggagcctgcctgcatcccctggacagcctggagcagaaggagactcaggagcaaacgtcgggccagctagtcatgctgaggaaggcacaggagttctttcagacctgtgatgctgaaggcaagggcttcatcgccaggaaggatatgcagaggctgcataaggagctaccgctcagcctggaggaactggaggatgtgtttgatgccctggatgctgatggcaatggctatctgaccccacaggagttcactactggatttagtcacttcttcttcagccagaataacccaagtcaggaagatgcaggtgaacaggtggcccagcgccatgaagagaaggtgtatctgtccagaggggatgaggatctgggcgacatgggcgaagatgaggaagcccagttccggatgctgatggacagacttggagcccaaaaggtgttggaagatgaaagtgatgtcaagcagctctggttgcagctgaagaaggaggaacctcatttactgtccaactttgaagacttcctgaccagaatcatctcccagctccaagaagcccatgaggagaagaatgaactggagtgtgccctaaaaaggaaaattgctgcttatgatgaagaaatccagcatctctatgaggagatggaacaacaaatcaaaagtgagaaggagcagtttctcctgaaggacacagagaggtttcaagcccgcagtcaagagctggagcagaaactgttatgtaaggagcaggagctggagcagctcacccagaagcagaaaaggctggaaggtcagtgcacagccctgcatcatgacaagcatgagaccaaggctgagaataccaagctgaaactcactaaccaggagctggcccgggagctggagcggacttcctgggagctccaggatgctcagcagcagttggaaagcctccagcaagaggcctgcaaactccaccaagagaaggagatggaagtgtaccgtgtgacggagagtctacagcgtgagaaggccgggctcctcaagcagctggatttcctaaggtgcgtcggtgggcactggcctgtgctgagagcacctcccagaagcctggggtcggaaggaccagtctga
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
83,193 Da
NCBI Official Full Name
Homo sapiens EF-hand calcium binding domain 4B, mRNA
NCBI Official Synonym Full Names
calcium release activated channel regulator 2A
NCBI Official Symbol
CRACR2A
NCBI Official Synonym Symbols
EFCAB4B
NCBI Protein Information
EF-hand calcium-binding domain-containing protein 4B
UniProt Protein Name
EF-hand calcium-binding domain-containing protein 4B
UniProt Gene Name
CRACR2A
UniProt Synonym Gene Names
EFCAB4B; CRAC channel regulator 2A
UniProt Entry Name
EFC4B_HUMAN

Uniprot Description

EFCAB4B: Ca(2+)-binding protein that plays a key role in store- operated Ca(2+) entry (SOCE) in T-cells by regulating CRAC channel activation. Acts as a cytoplasmic calcium-sensor that facilitates the clustering of ORAI1 and STIM1 at the junctional regions between the plasma membrane and the endoplasmic reticulum upon low Ca(2+) concentration. It thereby regulates CRAC channel activation, including translocation and clustering of ORAI1 and STIM1. Upon increase of cytoplasmic Ca(2+) resulting from opening of CRAC channels, dissociates from ORAI1 and STIM1, thereby destabilizing the ORAI1-STIM1 complex. Belongs to the EFCAB4 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Calcium-binding

Chromosomal Location of Human Ortholog: 12p13.32

Cellular Component: cytoplasm; Golgi apparatus; membrane; nucleolus; nucleus

Molecular Function: calcium ion binding; protein binding

Biological Process: activation of store-operated calcium channel activity; positive regulation of calcium ion transport

Research Articles on EFCAB4B

Similar Products

Product Notes

The EFCAB4B cracr2a (Catalog #AAA1271966) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgccc ctgacgggag ggtagtctcc agaccccaga gacttggtca ggggtctggc caggggccaa aggggagtgg agcctgcctg catcccctgg acagcctgga gcagaaggag actcaggagc aaacgtcggg ccagctagtc atgctgagga aggcacagga gttctttcag acctgtgatg ctgaaggcaa gggcttcatc gccaggaagg atatgcagag gctgcataag gagctaccgc tcagcctgga ggaactggag gatgtgtttg atgccctgga tgctgatggc aatggctatc tgaccccaca ggagttcact actggattta gtcacttctt cttcagccag aataacccaa gtcaggaaga tgcaggtgaa caggtggccc agcgccatga agagaaggtg tatctgtcca gaggggatga ggatctgggc gacatgggcg aagatgagga agcccagttc cggatgctga tggacagact tggagcccaa aaggtgttgg aagatgaaag tgatgtcaag cagctctggt tgcagctgaa gaaggaggaa cctcatttac tgtccaactt tgaagacttc ctgaccagaa tcatctccca gctccaagaa gcccatgagg agaagaatga actggagtgt gccctaaaaa ggaaaattgc tgcttatgat gaagaaatcc agcatctcta tgaggagatg gaacaacaaa tcaaaagtga gaaggagcag tttctcctga aggacacaga gaggtttcaa gcccgcagtc aagagctgga gcagaaactg ttatgtaagg agcaggagct ggagcagctc acccagaagc agaaaaggct ggaaggtcag tgcacagccc tgcatcatga caagcatgag accaaggctg agaataccaa gctgaaactc actaaccagg agctggcccg ggagctggag cggacttcct gggagctcca ggatgctcag cagcagttgg aaagcctcca gcaagaggcc tgcaaactcc accaagagaa ggagatggaa gtgtaccgtg tgacggagag tctacagcgt gagaaggccg ggctcctcaa gcagctggat ttcctaaggt gcgtcggtgg gcactggcct gtgctgagag cacctcccag aagcctgggg tcggaaggac cagtctga. It is sometimes possible for the material contained within the vial of "EFCAB4B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.