Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCR7 cdna clone

CXCR7 cDNA Clone

Gene Names
ACKR3; RDC1; CXCR7; RDC-1; CMKOR1; CXC-R7; CXCR-7; GPR159
Synonyms
CXCR7; CXCR7 cDNA Clone; CXCR7 cdna clone
Ordering
For Research Use Only!
Sequence
atggatctgcatctcttcgactactcagagccagggaacttctcggacatcagctggccatgcaacagcagcgactgcatcgtggtggacacggtgatgtgtcccaacatgcccaacaaaagcgtcctgctctacacgctctccttcatttacattttcatcttcgtcatcggcatgattgccaactccgtggtggtctgggtgaatatccaggccaagaccacaggctatgacacgcactgctacatcttgaacctggccattgccgacctgtgggttgtcctcaccatcccagtctgggtggtcagtctcgtgcagcacaaccagtggcccatgggcgagctcacgtgcaaagtcacacacctcatcttctccatcaacctcttcggcagcattttcttcctcacgtgcatgagcgtggaccgctacctctccatcacctacttcaccaacacccccagcagcaggaagaagatggtacgccgtgtcgtctgcatcctggtgtggctgctggccttctgcgtgtctctgcctgacacctactacctgaagaccgtcacgtctgcgtccaacaatgagacctactgccggtccttctaccccgagcacagcatcaaggagtggctgatcggcatggagctggtctccgttgtcttgggctttgccgttcccttctccattgtcgctgtcttctacttcctgctggccagagccatctcggcgtccagtgaccaggagaagcacagcagccggaagatcatcttctcctacgtggtggtcttccttgtctgctggttgccctaccacgtggcggtgctgctggacatcttctccatcctgcactacatccctttcacctgccggctggagcacgccctcttcacggccctgcatgtcacacagtgcctgtcgctggtgcactgctgcgtcaaccctgtcctctacagcttcatcaatcgcaactacaggtacgagctgatgaaggccttcatcttcaagtactcggccaaaacagggctcaccaagctcatcgatgcctccagagtctcagagacggagtactctgccttggagcagagcaccaaatga
Sequence Length
1089
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,493 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) receptor 7, mRNA
NCBI Official Synonym Full Names
atypical chemokine receptor 3
NCBI Official Symbol
ACKR3
NCBI Official Synonym Symbols
RDC1; CXCR7; RDC-1; CMKOR1; CXC-R7; CXCR-7; GPR159
NCBI Protein Information
atypical chemokine receptor 3
UniProt Protein Name
Atypical chemokine receptor 3
UniProt Gene Name
ACKR3
UniProt Synonym Gene Names
CMKOR1; CXCR7; GPR159; RDC1; CXC-R7; CXCR-7; RDC-1
UniProt Entry Name
ACKR3_HUMAN

NCBI Description

This gene encodes a member of the G-protein coupled receptor family. Although this protein was earlier thought to be a receptor for vasoactive intestinal peptide (VIP), it is now considered to be an orphan receptor, in that its endogenous ligand has not been identified. The protein is also a coreceptor for human immunodeficiency viruses (HIV). Translocations involving this gene and HMGA2 on chromosome 12 have been observed in lipomas. [provided by RefSeq, Jul 2008]

Uniprot Description

CMKOR1: Receptor for chemokines CXCL12/SDF1 and CXCL11. Does not elicit classical chemokine receptor signaling; chemokine binding does not activate G-protein-mediated signal transduction but instead induces beta-arrestin recruitment, leading to ligand internalization and activation of MAPK signaling pathway. Acts as a scavenger for CXCL12/SDF1 and, to a lesser extent, for CXCL11. Required for regulation of CXCR4 protein levels in migrating interneurons, thereby adapting their chemokine responsiveness. In glioma cells, transduces signals via MEK/ERK pathway, mediating resistance to apoptosis. Promotes cell growth and survival. Not involved in cell migration, adhesion or proliferation of normal hematopoietic progenitors but activated by CXCL11 in malignant hemapoietic cells, leading to phosphorylation of ERK1/2 (MAPK3/MAPK1) and enhanced cell adhesion and migration. Plays a regulatory role in CXCR4-mediated activation of cell surface integrins by CXCL12. Required for heart valve development. Acts as coreceptor with CXCR4 for a restricted number of HIV isolates. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Membrane protein, integral; Membrane protein, multi-pass; Receptor, GPCR

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: cell surface; coated pit; endosome; intracellular membrane-bound organelle; plasma membrane

Molecular Function: C-X-C chemokine binding; C-X-C chemokine receptor activity; protein binding; scavenger receptor activity

Biological Process: positive regulation of defense response to virus by host; receptor internalization

Research Articles on CXCR7

Similar Products

Product Notes

The CXCR7 ackr3 (Catalog #AAA1268255) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatctgc atctcttcga ctactcagag ccagggaact tctcggacat cagctggcca tgcaacagca gcgactgcat cgtggtggac acggtgatgt gtcccaacat gcccaacaaa agcgtcctgc tctacacgct ctccttcatt tacattttca tcttcgtcat cggcatgatt gccaactccg tggtggtctg ggtgaatatc caggccaaga ccacaggcta tgacacgcac tgctacatct tgaacctggc cattgccgac ctgtgggttg tcctcaccat cccagtctgg gtggtcagtc tcgtgcagca caaccagtgg cccatgggcg agctcacgtg caaagtcaca cacctcatct tctccatcaa cctcttcggc agcattttct tcctcacgtg catgagcgtg gaccgctacc tctccatcac ctacttcacc aacaccccca gcagcaggaa gaagatggta cgccgtgtcg tctgcatcct ggtgtggctg ctggccttct gcgtgtctct gcctgacacc tactacctga agaccgtcac gtctgcgtcc aacaatgaga cctactgccg gtccttctac cccgagcaca gcatcaagga gtggctgatc ggcatggagc tggtctccgt tgtcttgggc tttgccgttc ccttctccat tgtcgctgtc ttctacttcc tgctggccag agccatctcg gcgtccagtg accaggagaa gcacagcagc cggaagatca tcttctccta cgtggtggtc ttccttgtct gctggttgcc ctaccacgtg gcggtgctgc tggacatctt ctccatcctg cactacatcc ctttcacctg ccggctggag cacgccctct tcacggccct gcatgtcaca cagtgcctgt cgctggtgca ctgctgcgtc aaccctgtcc tctacagctt catcaatcgc aactacaggt acgagctgat gaaggccttc atcttcaagt actcggccaa aacagggctc accaagctca tcgatgcctc cagagtctca gagacggagt actctgcctt ggagcagagc accaaatga. It is sometimes possible for the material contained within the vial of "CXCR7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.