Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CKM cdna clone

CKM cDNA Clone

Gene Names
CKM; CKMM; M-CK
Synonyms
CKM; CKM cDNA Clone; CKM cdna clone
Ordering
For Research Use Only!
Sequence
atgccattcggtaacacccacaacaagttcaagctgaattacaagcctgaggaggagtaccccgacctcagcaaacataacaaccacatggccaaggtactgacccttgaactctacaagaagctgcgggacaaggagactccatctggcttcactgtagacgatgtcatccagacaggagtggacaacccaggtcaccccttcatcatgaccgtgggctgcgtggctggtgatgaggagtcctacgaagttttcaaggaactctttgaccccatcatctcggatcgccacgggggctacaaacccactgacaagcacaagactgacctcaaccatgaaaacctcaagggtggagacgacctggaccccaactacgtgctcagcagccgcgtccgcactggccgcagcatcaagggctacacgttgcccccacactgctcccgtggcgagcgccgggcggtggagaagctctctgtggaagctctcaacagcctgacgggcgagttcaaagggaagtactaccctctgaagagcatgacggagaaggagcagcagcagctcatcgatgaccacttcctgttcgacaagcccgtgtccccgctgctgctggcctcaggcatggcccgcgactggcccgacgcccgtggcatctggcacaatgacaacaagagcctcctggtgtgggtgaacgaggaggatcacctccgggtcatctccatggagaaggggggcaacatgaaggaggttttccgccgcttctgcgtagggctgcagaagattgaggagatctttaagaaagctggccaccccttcatgtggaaccagcacctgggctacgtgctcacctgcccatccaacctgggcactgggctgcgtggaggcgtgcatgtgaagctggcgcacctgagcaagcaccccaagttcgaggagatcctcacccgcctgcgtctgcagaagaggggtacaggtggcgtggacacagctgccgtgggctcagtatttgacgtgtccaacgctgatcggctgggctcgtccgaagtagaacaggtgcagctggtggtggatggtgtgaagctcatggtggaaatggagaagaagttggagaaaggccagtccatcgacgacatgatccccgcccagaagtag
Sequence Length
1146
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,101 Da
NCBI Official Full Name
Homo sapiens creatine kinase, muscle, mRNA
NCBI Official Synonym Full Names
creatine kinase, M-type
NCBI Official Symbol
CKM
NCBI Official Synonym Symbols
CKMM; M-CK
NCBI Protein Information
creatine kinase M-type
UniProt Protein Name
Creatine kinase M-type
Protein Family
UniProt Gene Name
CKM
UniProt Synonym Gene Names
CKMM
UniProt Entry Name
KCRM_HUMAN

NCBI Description

The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]

Uniprot Description

CKM: Reversibly catalyzes the transfer of phosphate between ATP and various phosphogens (e.g. creatine phosphate). Creatine kinase isoenzymes play a central role in energy transduction in tissues with large, fluctuating energy demands, such as skeletal muscle, heart, brain and spermatozoa. Belongs to the ATP:guanido phosphotransferase family.

Protein type: EC 2.7.3.2; Amino Acid Metabolism - arginine and proline; Kinase, other

Chromosomal Location of Human Ortholog: 19q13.32

Cellular Component: cytosol

Molecular Function: creatine kinase activity; protein binding

Biological Process: creatine metabolic process

Research Articles on CKM

Similar Products

Product Notes

The CKM ckm (Catalog #AAA1273583) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccattcg gtaacaccca caacaagttc aagctgaatt acaagcctga ggaggagtac cccgacctca gcaaacataa caaccacatg gccaaggtac tgacccttga actctacaag aagctgcggg acaaggagac tccatctggc ttcactgtag acgatgtcat ccagacagga gtggacaacc caggtcaccc cttcatcatg accgtgggct gcgtggctgg tgatgaggag tcctacgaag ttttcaagga actctttgac cccatcatct cggatcgcca cgggggctac aaacccactg acaagcacaa gactgacctc aaccatgaaa acctcaaggg tggagacgac ctggacccca actacgtgct cagcagccgc gtccgcactg gccgcagcat caagggctac acgttgcccc cacactgctc ccgtggcgag cgccgggcgg tggagaagct ctctgtggaa gctctcaaca gcctgacggg cgagttcaaa gggaagtact accctctgaa gagcatgacg gagaaggagc agcagcagct catcgatgac cacttcctgt tcgacaagcc cgtgtccccg ctgctgctgg cctcaggcat ggcccgcgac tggcccgacg cccgtggcat ctggcacaat gacaacaaga gcctcctggt gtgggtgaac gaggaggatc acctccgggt catctccatg gagaaggggg gcaacatgaa ggaggttttc cgccgcttct gcgtagggct gcagaagatt gaggagatct ttaagaaagc tggccacccc ttcatgtgga accagcacct gggctacgtg ctcacctgcc catccaacct gggcactggg ctgcgtggag gcgtgcatgt gaagctggcg cacctgagca agcaccccaa gttcgaggag atcctcaccc gcctgcgtct gcagaagagg ggtacaggtg gcgtggacac agctgccgtg ggctcagtat ttgacgtgtc caacgctgat cggctgggct cgtccgaagt agaacaggtg cagctggtgg tggatggtgt gaagctcatg gtggaaatgg agaagaagtt ggagaaaggc cagtccatcg acgacatgat ccccgcccag aagtag. It is sometimes possible for the material contained within the vial of "CKM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.