Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD48 cdna clone

CD48 cDNA Clone

Gene Names
CD48; BCM1; BLAST; hCD48; mCD48; BLAST1; SLAMF2; MEM-102
Synonyms
CD48; CD48 cDNA Clone; CD48 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggttttatactttcgaccagaagattgtagaatgggattccagaaaatctaagtactttgaatccaaatttaaaggcagggtcagacttgatcctcagagtggcgcactgtacatctctaaggtccagaaagaggacaacagcacctacatcatgagggtgttgaaaaagactgggaatgagcaagaatggaagatcaagctgcaagtgcttgaccctgtacccaagcctgtcatcaaaattgagaagatagaagacatggatgacaactgttatttgaaactgtcatgtgtgatacctggcgagtctgtaaactacacctggtatggggacaaaaggcccttcccaaaggagctccagaacagtgtgcttgaaaccacccttatgccacataattactccaggtgttatacttgccaagtcagcaattctgtgagcagcaagaatggcacggtctgcctcagtccaccctgtaccctggcccggtcctttggagtagaatggattgcaagttggctagtggtcacggtgcccaccattcttggcctgttacttacctga
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
962
Molecular Weight
19,429 Da
NCBI Official Full Name
Homo sapiens CD48 molecule, mRNA
NCBI Official Synonym Full Names
CD48 molecule
NCBI Official Symbol
CD48
NCBI Official Synonym Symbols
BCM1; BLAST; hCD48; mCD48; BLAST1; SLAMF2; MEM-102
NCBI Protein Information
CD48 antigen
UniProt Protein Name
CD48 antigen
Protein Family
UniProt Gene Name
CD48
UniProt Synonym Gene Names
BCM1; BLAST1; SLAMF2
UniProt Entry Name
CD48_HUMAN

NCBI Description

This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

CD48: Ligand for CD2. Might facilitate interaction between activated lymphocytes. Probably involved in regulating T-cell activation.

Protein type: Membrane protein, GPI anchor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1q21.3-q22

Cellular Component: integral to plasma membrane; lipid raft; membrane; plasma membrane

Molecular Function: protein binding

Biological Process: defense response; leukocyte migration

Research Articles on CD48

Similar Products

Product Notes

The CD48 cd48 (Catalog #AAA1268790) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgctcca gaggttggga ttcgtgtctg gctctggaat tgctactgct gcctctgtca ctcctggtga ccagcattca aggtcacttg gtacatatga ccgtggtctc cggcagcaac gtgactctga acatctctga gagcctgcct gagaactaca aacaactaac ctggttttat actttcgacc agaagattgt agaatgggat tccagaaaat ctaagtactt tgaatccaaa tttaaaggca gggtcagact tgatcctcag agtggcgcac tgtacatctc taaggtccag aaagaggaca acagcaccta catcatgagg gtgttgaaaa agactgggaa tgagcaagaa tggaagatca agctgcaagt gcttgaccct gtacccaagc ctgtcatcaa aattgagaag atagaagaca tggatgacaa ctgttatttg aaactgtcat gtgtgatacc tggcgagtct gtaaactaca cctggtatgg ggacaaaagg cccttcccaa aggagctcca gaacagtgtg cttgaaacca cccttatgcc acataattac tccaggtgtt atacttgcca agtcagcaat tctgtgagca gcaagaatgg cacggtctgc ctcagtccac cctgtaccct ggcccggtcc tttggagtag aatggattgc aagttggcta gtggtcacgg tgcccaccat tcttggcctg ttacttacct ga. It is sometimes possible for the material contained within the vial of "CD48, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.