Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CBX8 cdna clone

CBX8 cDNA Clone

Gene Names
CBX8; PC3; RC1
Synonyms
CBX8; CBX8 cDNA Clone; CBX8 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctttcagcggtgggggagcgggtgttcgcggccgaagccctcctgaagcggcgcatacggaaaggacgcatggaatacctcgtgaaatggaagggatggtcgcagaagtacagcacatgggaaccggaggaaaacatcctggatgctcgcttgctcgcagcctttgaggaaagggaaagagagatggagctctatggccccaaaaagcgtggacccaagcccaaaaccttcctcctcaaagcgcaggccaaggcaaaggccaaaacttacgagtttcgaagtgactcagccaggggcatccggatcccctaccctggccgctcgccccaggacctggcctccacttcccgggcccgggagggccttcgaaacatgggtttgtccccgccagcgagcagcaccagcaccagcagcacctgccgcgcagaggcccctcgggaccgggaccgagaccgggatagggaccgggagcgggatcgagaaagggagagggagcgagagagggagcgggaacgtgagagggaacgagagcggggtaccagcagagtggatgacaagcccagctcaccgggggacagctcgaagaagcgaggccccaagccccggaaggagctcccggacccctcacagaggcccttaggcgaacccagcgccggcctcggagagtacctcaagggcaggaagctggacgacaccccttccggggcaggaaagtttccagccggccacagtgtgatccagctggcccgaagacaggactcggacctggtgcagtgtggtgtgaccagccctagctcagctgaggccacgggcaaactggctgtggacaccttcccggccagggtgataaagcacagggctgccttcctggaggccaaaggccagggtgccctagatcccaatggcacccgggtccgacatggctcaggcccccccagctctggggggggcctgtaccgggacatgggggcccaggggggaaggccctccctcatcgccaggatccctgtggccagaatcctgggggacccggaggaagagtcctggagcccctccctgactaacctggagaaggtggtggtcacggacgtgacctcaaactttttgaccgtcaccattaaggaaagtaacacggaccaaggcttttttaaagagaaaagatga
Sequence Length
1170
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,396 Da
NCBI Official Full Name
Homo sapiens chromobox homolog 8 (Pc class homolog, Drosophila), mRNA
NCBI Official Synonym Full Names
chromobox 8
NCBI Official Symbol
CBX8
NCBI Official Synonym Symbols
PC3; RC1
NCBI Protein Information
chromobox protein homolog 8
UniProt Protein Name
Chromobox protein homolog 8
Protein Family
UniProt Gene Name
CBX8
UniProt Synonym Gene Names
PC3; RC1; Pc3; hPc3
UniProt Entry Name
CBX8_HUMAN

Uniprot Description

CBX8: Component of a Polycomb group (PcG) multiprotein PRC1- like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: nuclear chromatin; nucleoplasm; nucleus; PcG protein complex

Molecular Function: methylated histone residue binding; protein binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; protein sumoylation

Research Articles on CBX8

Similar Products

Product Notes

The CBX8 cbx8 (Catalog #AAA1278486) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcttt cagcggtggg ggagcgggtg ttcgcggccg aagccctcct gaagcggcgc atacggaaag gacgcatgga atacctcgtg aaatggaagg gatggtcgca gaagtacagc acatgggaac cggaggaaaa catcctggat gctcgcttgc tcgcagcctt tgaggaaagg gaaagagaga tggagctcta tggccccaaa aagcgtggac ccaagcccaa aaccttcctc ctcaaagcgc aggccaaggc aaaggccaaa acttacgagt ttcgaagtga ctcagccagg ggcatccgga tcccctaccc tggccgctcg ccccaggacc tggcctccac ttcccgggcc cgggagggcc ttcgaaacat gggtttgtcc ccgccagcga gcagcaccag caccagcagc acctgccgcg cagaggcccc tcgggaccgg gaccgagacc gggataggga ccgggagcgg gatcgagaaa gggagaggga gcgagagagg gagcgggaac gtgagaggga acgagagcgg ggtaccagca gagtggatga caagcccagc tcaccggggg acagctcgaa gaagcgaggc cccaagcccc ggaaggagct cccggacccc tcacagaggc ccttaggcga acccagcgcc ggcctcggag agtacctcaa gggcaggaag ctggacgaca ccccttccgg ggcaggaaag tttccagccg gccacagtgt gatccagctg gcccgaagac aggactcgga cctggtgcag tgtggtgtga ccagccctag ctcagctgag gccacgggca aactggctgt ggacaccttc ccggccaggg tgataaagca cagggctgcc ttcctggagg ccaaaggcca gggtgcccta gatcccaatg gcacccgggt ccgacatggc tcaggccccc ccagctctgg ggggggcctg taccgggaca tgggggccca ggggggaagg ccctccctca tcgccaggat ccctgtggcc agaatcctgg gggacccgga ggaagagtcc tggagcccct ccctgactaa cctggagaag gtggtggtca cggacgtgac ctcaaacttt ttgaccgtca ccattaagga aagtaacacg gaccaaggct tttttaaaga gaaaagatga. It is sometimes possible for the material contained within the vial of "CBX8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.