Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CARS cdna clone

CARS cDNA Clone

Gene Names
CARS; CARS1; CYSRS; MGC:11246
Synonyms
CARS; CARS cDNA Clone; CARS cdna clone
Ordering
For Research Use Only!
Sequence
atggcagattcctccgggcagcagggcaaaggccggcgtgtgcagccccagtggtcccctcctgctgggacccagccatgcagactccacctttacaacagcctcaccaggaacaaggaagtgttcatacctcaagatgggaaaaaggtgacgtggtattgctgtgggccaaccgtctatgacgcatctcacatggggcacgccaggtcctacatctcttttgatatcttgagaagagtgttgaaggattacttcaaatttgatgtcttttattgcatgaacattacggatattgatgacaagatcatcaagagggcccggcagaaccacctgttcgagcagtatcgggagaagaggcctgaagcggcacagctcttggaggatgttcaggccgccctgaagccattttcagtaaaattaaatgagaccacggatcccgataaaaagcagatgctcgaacggattcagcacgcagtgcagcttgccacagagccacttgagaaagctgtgcagtccagactcacgggagaggaagtcaacagctgtgtggaggtgttgctggaagaagccaaggatttgctctctgactggctggattctacacttggctgtgatgtcactgacaattccatcttctccaagctgcccaagttctgggagggggacttccacagagacatggaagctctgaatgttctccctccagatgtcttaacccgggttagtgagtatgtgccagaaattgtgaactttgtccagaagattgtggacaacggttacggctatgtctccaatgggtctgtctactttgatacagcgaagtttgcttctagcgagaagcactcctatgggaagctggtgcctgaggccgttggagatcagaaagcccttcaagaaggggaaggtgacctgagcatctctgcagaccgcctgagtgagaagcgctctcccaacgactttgccttatggaaggcctctaagcccggagaaccgtcctggccgtgcccttggggaaagggtcgtccgggctggcatatcgagtgctcggccatggcaggcaccctcctaggggcttcgatggacattcacggaggtgggttcgacctccggttcccccaccatgacaatgagctggcacagtcggaggcctactttgaaaacgactgctgggtcaggtacttcctgcacacaggccacctgaccattgcaggctgcaaaatgtcaaagtcactaaaaaacttcatcaccattaaagatgccttgaaaaagcactcagcacggcagttgcggctggccttcctcatgcactcgtggaaggacaccctggactactccagcaacaccatggagtcagcgcttcaatatgagaagttcttgaatgagtttttcttaaatgtgaaagatatccttcgcgctcctgttgacatcactggtcagtttgagaagtggggagaagaagaagcagaactgaataagaacttttatgacaagaagacagcaattcacaaagccctctgtgacaatgttgacacccgcaccgtcatggaagagatgcgggccttggtcagtcagtgcaacctctatatggcagcccggaaagccgtgaggaagaggcccaaccaggctctgctggagaacatcgccctgtacctcacccatatgctgaagatctttggggccgtagaagaggacagctccctgggattcccggtcggagggcctggaaccagcctcagtctcgaggccacagtcatgccctaccttcaggtgttatcagaattccgagaaggagtgcggaagattgcccgagagcaaaaagtccctgagattctgcagctcagcgatgccctgcgggacaacatcctgcccgagcttggggtgcggtttgaagaccacgaaggactgcccacagtggtgaaactggtagacagaaacaccttattaaaagagagagaagaaaagagacgggttgaagaggagaagaggaagaagaaagaggaggcggcccggaggaaacaggaacaagaagcagcaaagctggccaagatgaagattccccccagtgagatgttcttgtcagaaaccgacaaatactccaagtttgatgaaaatggtctgcccacacatgacatggagggcaaagagctcagcaaagggcaagccaagaagctgaagaagctcttcgaggctcaggagaagctctacaaggaatatctgcagatggcccagaatggaagcttccagtga
Sequence Length
2247
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
833
Molecular Weight
94,638 Da
NCBI Official Full Name
Homo sapiens cysteinyl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
cysteinyl-tRNA synthetase
NCBI Official Symbol
CARS
NCBI Official Synonym Symbols
CARS1; CYSRS; MGC:11246
NCBI Protein Information
cysteine--tRNA ligase, cytoplasmic
UniProt Protein Name
Cysteine--tRNA ligase, cytoplasmic
Protein Family
UniProt Gene Name
CARS
UniProt Synonym Gene Names
CysRS
UniProt Entry Name
SYCC_HUMAN

NCBI Description

This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]

Uniprot Description

CARS: a class 1 aminoacyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. Two alternatively spliced isoforms are described.

Protein type: Translation; Oncoprotein; EC 6.1.1.16; Ligase

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: cytoplasm; cytosol

Molecular Function: ATP binding; cysteine-tRNA ligase activity; protein binding; protein homodimerization activity; tRNA binding

Biological Process: cysteinyl-tRNA aminoacylation; tRNA aminoacylation for protein translation

Research Articles on CARS

Similar Products

Product Notes

The CARS cars (Catalog #AAA1273062) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagatt cctccgggca gcagggcaaa ggccggcgtg tgcagcccca gtggtcccct cctgctggga cccagccatg cagactccac ctttacaaca gcctcaccag gaacaaggaa gtgttcatac ctcaagatgg gaaaaaggtg acgtggtatt gctgtgggcc aaccgtctat gacgcatctc acatggggca cgccaggtcc tacatctctt ttgatatctt gagaagagtg ttgaaggatt acttcaaatt tgatgtcttt tattgcatga acattacgga tattgatgac aagatcatca agagggcccg gcagaaccac ctgttcgagc agtatcggga gaagaggcct gaagcggcac agctcttgga ggatgttcag gccgccctga agccattttc agtaaaatta aatgagacca cggatcccga taaaaagcag atgctcgaac ggattcagca cgcagtgcag cttgccacag agccacttga gaaagctgtg cagtccagac tcacgggaga ggaagtcaac agctgtgtgg aggtgttgct ggaagaagcc aaggatttgc tctctgactg gctggattct acacttggct gtgatgtcac tgacaattcc atcttctcca agctgcccaa gttctgggag ggggacttcc acagagacat ggaagctctg aatgttctcc ctccagatgt cttaacccgg gttagtgagt atgtgccaga aattgtgaac tttgtccaga agattgtgga caacggttac ggctatgtct ccaatgggtc tgtctacttt gatacagcga agtttgcttc tagcgagaag cactcctatg ggaagctggt gcctgaggcc gttggagatc agaaagccct tcaagaaggg gaaggtgacc tgagcatctc tgcagaccgc ctgagtgaga agcgctctcc caacgacttt gccttatgga aggcctctaa gcccggagaa ccgtcctggc cgtgcccttg gggaaagggt cgtccgggct ggcatatcga gtgctcggcc atggcaggca ccctcctagg ggcttcgatg gacattcacg gaggtgggtt cgacctccgg ttcccccacc atgacaatga gctggcacag tcggaggcct actttgaaaa cgactgctgg gtcaggtact tcctgcacac aggccacctg accattgcag gctgcaaaat gtcaaagtca ctaaaaaact tcatcaccat taaagatgcc ttgaaaaagc actcagcacg gcagttgcgg ctggccttcc tcatgcactc gtggaaggac accctggact actccagcaa caccatggag tcagcgcttc aatatgagaa gttcttgaat gagtttttct taaatgtgaa agatatcctt cgcgctcctg ttgacatcac tggtcagttt gagaagtggg gagaagaaga agcagaactg aataagaact tttatgacaa gaagacagca attcacaaag ccctctgtga caatgttgac acccgcaccg tcatggaaga gatgcgggcc ttggtcagtc agtgcaacct ctatatggca gcccggaaag ccgtgaggaa gaggcccaac caggctctgc tggagaacat cgccctgtac ctcacccata tgctgaagat ctttggggcc gtagaagagg acagctccct gggattcccg gtcggagggc ctggaaccag cctcagtctc gaggccacag tcatgcccta ccttcaggtg ttatcagaat tccgagaagg agtgcggaag attgcccgag agcaaaaagt ccctgagatt ctgcagctca gcgatgccct gcgggacaac atcctgcccg agcttggggt gcggtttgaa gaccacgaag gactgcccac agtggtgaaa ctggtagaca gaaacacctt attaaaagag agagaagaaa agagacgggt tgaagaggag aagaggaaga agaaagagga ggcggcccgg aggaaacagg aacaagaagc agcaaagctg gccaagatga agattccccc cagtgagatg ttcttgtcag aaaccgacaa atactccaag tttgatgaaa atggtctgcc cacacatgac atggagggca aagagctcag caaagggcaa gccaagaagc tgaagaagct cttcgaggct caggagaagc tctacaagga atatctgcag atggcccaga atggaagctt ccagtga. It is sometimes possible for the material contained within the vial of "CARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.