Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGEF5 cdna clone

ARHGEF5 cDNA Clone

Gene Names
ARHGEF5; P60; TIM; GEF5; TIM1
Synonyms
ARHGEF5; ARHGEF5 cDNA Clone; ARHGEF5 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaggcttttcaagacgctgctccaaactcatcaactcctcccagctgctttaccaggagtatagtgatgttgtcctgaataaggagatccagagccagcagcggctggagagcctgtccgagacacccgggcctagctctccgcggcagcctcggaaggccctggtctcctccgagtcgtacctgcagcggctctccatggcctccagcggctccctctggcaggaaatccccgtggtgcgcaacagcaccgtgctgctctccatgacccatgaagaccaaaagctgcaagaggtcaaatttgagctgattgtgtcagaggcctcctacctgcgcagtctaaacatagctgtggatcatttccaactttcaacttcactccgggccacactttccaaccaggagcaccaatggctcttctctcgtttacaggatgtgcgagacgtcagcgccacgttcctttcagacctggaagagaactttgagaacaatatcttctccttccaagtatgtgacgtagtcctgaaccacgccccagacttccgccgggtctacctgccttatgtcaccaaccagacctatcaggaacgcaccttccagagcctgatgaatagcaacagcaatttccgggaggtcttggagaagctggagagcgaccccgtctgccagcgcctttccctcaagtcctttctgattctgcccttccaacgcatcacccgcctcaaactgctgctccagaacattctgaagagaacacagcctggctcctcggaggaggcagaggccacgaaggcacaccacgccctggagcagctgatccgggactgcaataacaatgtccagagtatgcgacggacagaggagctaatctacctgagccagaagattgagtttgagtgcaaaatattcccgctcatttctcagtcacgctggctggtgaaaagtggggagctgacagccttggagttcagtgcttccccagggctacgaaggaagctgaacacgcgtccagtccacctgcacctcttcaatgactgtctgctgctgtctcggccccgagagggtagccgattcctggtatttgaccatgctcccttctcctccattcggggggaaaagtgtgaaatgaagctacatggacctcacaaaaacctgttccgactctttctgcggcagaacactcagggcgcccaggccgagttcctcttccgcacggagactcaaagtgaaaagcttcggtggatctcagccttggccatgccaagagaggagttggaccttctggagtgttacaactccccccaggtacagtgccttcgagcctacaagccccgagagaatgatgaattggcactggagaaagccgacgtggtgatggtgactcagcagagcagtgacggctggctggagggcgtgaggctctcagacggggagcgaggctggtttcctgtgcagcaggtggagttcatttccaacccagaggtccgtgcacagaacctgaaggaagctcatcgagtcaagactgccaaactacagctggtggaacagcaagcctaa
Sequence Length
1560
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,056 Da
NCBI Official Full Name
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 5, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 5
NCBI Official Symbol
ARHGEF5
NCBI Official Synonym Symbols
P60; TIM; GEF5; TIM1
NCBI Protein Information
rho guanine nucleotide exchange factor 5
UniProt Protein Name
Rho guanine nucleotide exchange factor 5
UniProt Gene Name
ARHGEF5
UniProt Synonym Gene Names
TIM
UniProt Entry Name
ARHG5_HUMAN

NCBI Description

Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]

Uniprot Description

ARHGEF5: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs, Rac/Rho; GEFs; Motility/polarity/chemotaxis; Oncoprotein

Chromosomal Location of Human Ortholog: 7q35

Cellular Component: cytoplasm; nucleoplasm; nucleus; plasma membrane

Molecular Function: GTP binding; guanyl-nucleotide exchange factor activity; protein binding

Biological Process: positive regulation of JNK activity; positive regulation of stress fiber formation; positive regulation of transcription factor activity; regulation of actin cytoskeleton organization and biogenesis; regulation of cytoskeleton organization and biogenesis; regulation of GTPase activity

Research Articles on ARHGEF5

Similar Products

Product Notes

The ARHGEF5 arhgef5 (Catalog #AAA1278911) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaggct tttcaagacg ctgctccaaa ctcatcaact cctcccagct gctttaccag gagtatagtg atgttgtcct gaataaggag atccagagcc agcagcggct ggagagcctg tccgagacac ccgggcctag ctctccgcgg cagcctcgga aggccctggt ctcctccgag tcgtacctgc agcggctctc catggcctcc agcggctccc tctggcagga aatccccgtg gtgcgcaaca gcaccgtgct gctctccatg acccatgaag accaaaagct gcaagaggtc aaatttgagc tgattgtgtc agaggcctcc tacctgcgca gtctaaacat agctgtggat catttccaac tttcaacttc actccgggcc acactttcca accaggagca ccaatggctc ttctctcgtt tacaggatgt gcgagacgtc agcgccacgt tcctttcaga cctggaagag aactttgaga acaatatctt ctccttccaa gtatgtgacg tagtcctgaa ccacgcccca gacttccgcc gggtctacct gccttatgtc accaaccaga cctatcagga acgcaccttc cagagcctga tgaatagcaa cagcaatttc cgggaggtct tggagaagct ggagagcgac cccgtctgcc agcgcctttc cctcaagtcc tttctgattc tgcccttcca acgcatcacc cgcctcaaac tgctgctcca gaacattctg aagagaacac agcctggctc ctcggaggag gcagaggcca cgaaggcaca ccacgccctg gagcagctga tccgggactg caataacaat gtccagagta tgcgacggac agaggagcta atctacctga gccagaagat tgagtttgag tgcaaaatat tcccgctcat ttctcagtca cgctggctgg tgaaaagtgg ggagctgaca gccttggagt tcagtgcttc cccagggcta cgaaggaagc tgaacacgcg tccagtccac ctgcacctct tcaatgactg tctgctgctg tctcggcccc gagagggtag ccgattcctg gtatttgacc atgctccctt ctcctccatt cggggggaaa agtgtgaaat gaagctacat ggacctcaca aaaacctgtt ccgactcttt ctgcggcaga acactcaggg cgcccaggcc gagttcctct tccgcacgga gactcaaagt gaaaagcttc ggtggatctc agccttggcc atgccaagag aggagttgga ccttctggag tgttacaact ccccccaggt acagtgcctt cgagcctaca agccccgaga gaatgatgaa ttggcactgg agaaagccga cgtggtgatg gtgactcagc agagcagtga cggctggctg gagggcgtga ggctctcaga cggggagcga ggctggtttc ctgtgcagca ggtggagttc atttccaacc cagaggtccg tgcacagaac ctgaaggaag ctcatcgagt caagactgcc aaactacagc tggtggaaca gcaagcctaa. It is sometimes possible for the material contained within the vial of "ARHGEF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.