Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCRN4L cdna clone

CCRN4L cDNA Clone

Gene Names
NOCT; NOC; CCR4L; Ccr4c; CCRN4L
Synonyms
CCRN4L; CCRN4L cDNA Clone; CCRN4L cdna clone
Ordering
For Research Use Only!
Sequence
atgtttcatagtccgcggcggctctgctcggccctgctgcagagggacgcgcccggcctgcgccgcctgcccgccccagggctgcgccgcccgttgtccccgccggctgctgttcccaggcccgcatccccccggctgctggcggcggcctcggcggcctcgggcgccgcgaggtcgtgttcccgaacagtgtgttccatgggaaccggtacaagcagactctatagtgctctcgccaagacactgaacagcagcgctgcctcccagcacccagagtatttggtgtcacctgacccagagcatctggagcccattgatcctaaagagcttcttgaggaatgcagggccgtcctgcacacccgacctccccggttccagagggattttgtggatctgaggacagattgccctagtacccacccacctatcagggttatgcaatggaacatcctcgcccaagctcttggagaaggcaaagacaactttgtacagtgccctgttgaagcactcaaatgggaagaaaggaaatgtctcatcctggaagaaatcctggcctaccagcctgatatattgtgcctccaagaggtggaccactattttgacaccttccagccactcctcagtagactaggctatcaaggcacgtttttccccaaaccctggtcaccttgtctagatgtagaacacaacaatggaccagatggttgtgccttattttttcttcaaaaccgattcaagctagtcaacagtgccaatattaggctgacagccatgacattgaaaaccaaccaggtggccattgcacagaccctggagtgcaaggagtcaggccgacagttctgcatcgctgttacccatctaaaagcacgcactggctgggagcggtttcgatcagctcaaggctgtgacctccttcagaacctgcaaaacatcacccaaggagccaagattccccttattgtgtgtggggacttcaatgcagagccaacagaagaggtctacaaacactttgcttcctccagcctcaacctgaacagcgcctacaagctgctgagtgctgatgggcagtcagaacccccatacactacctggaagatccggacctcaggggagtgcaggcacaccctggattacatctggtattctaaacatgctctaaatgtaaggtcagctctcgatctgctcactgaagaacagattggacccaacaggttaccttccttcaattatccttcagaccacctgtctctagtgtgtgacttcagctttactgaggaatctgatggactttcataa
Sequence Length
1296
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,196 Da
NCBI Official Full Name
Homo sapiens CCR4 carbon catabolite repression 4-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
nocturnin
NCBI Official Symbol
NOCT
NCBI Official Synonym Symbols
NOC; CCR4L; Ccr4c; CCRN4L
NCBI Protein Information
nocturnin
UniProt Protein Name
Nocturnin
UniProt Gene Name
NOCT
UniProt Entry Name
NOCT_HUMAN

NCBI Description

The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]

Uniprot Description

CCRN4L: Component of the circadian clock or downstream effector of clock function. Exhibits a high amplitude circadian rhythm with maximal levels in early evening. In constant darkness or constant light, the amplitude of the rhythm decreases. Belongs to the CCR4/nocturin family.

Protein type: EC 3.1.13.4

Chromosomal Location of Human Ortholog: 4q31.1

Cellular Component: cytoplasm; nucleoplasm; nucleus; perinuclear region of cytoplasm

Molecular Function: mRNA binding; poly(A)-specific ribonuclease activity; transcription factor activity

Biological Process: circadian regulation of gene expression; circadian rhythm; mRNA stabilization; negative regulation of osteoblast differentiation; positive regulation of fat cell differentiation; regulation of circadian rhythm; response to extracellular stimulus; response to lipopolysaccharide; transcription from RNA polymerase II promoter

Research Articles on CCRN4L

Similar Products

Product Notes

The CCRN4L noct (Catalog #AAA1276444) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttcata gtccgcggcg gctctgctcg gccctgctgc agagggacgc gcccggcctg cgccgcctgc ccgccccagg gctgcgccgc ccgttgtccc cgccggctgc tgttcccagg cccgcatccc cccggctgct ggcggcggcc tcggcggcct cgggcgccgc gaggtcgtgt tcccgaacag tgtgttccat gggaaccggt acaagcagac tctatagtgc tctcgccaag acactgaaca gcagcgctgc ctcccagcac ccagagtatt tggtgtcacc tgacccagag catctggagc ccattgatcc taaagagctt cttgaggaat gcagggccgt cctgcacacc cgacctcccc ggttccagag ggattttgtg gatctgagga cagattgccc tagtacccac ccacctatca gggttatgca atggaacatc ctcgcccaag ctcttggaga aggcaaagac aactttgtac agtgccctgt tgaagcactc aaatgggaag aaaggaaatg tctcatcctg gaagaaatcc tggcctacca gcctgatata ttgtgcctcc aagaggtgga ccactatttt gacaccttcc agccactcct cagtagacta ggctatcaag gcacgttttt ccccaaaccc tggtcacctt gtctagatgt agaacacaac aatggaccag atggttgtgc cttatttttt cttcaaaacc gattcaagct agtcaacagt gccaatatta ggctgacagc catgacattg aaaaccaacc aggtggccat tgcacagacc ctggagtgca aggagtcagg ccgacagttc tgcatcgctg ttacccatct aaaagcacgc actggctggg agcggtttcg atcagctcaa ggctgtgacc tccttcagaa cctgcaaaac atcacccaag gagccaagat tccccttatt gtgtgtgggg acttcaatgc agagccaaca gaagaggtct acaaacactt tgcttcctcc agcctcaacc tgaacagcgc ctacaagctg ctgagtgctg atgggcagtc agaaccccca tacactacct ggaagatccg gacctcaggg gagtgcaggc acaccctgga ttacatctgg tattctaaac atgctctaaa tgtaaggtca gctctcgatc tgctcactga agaacagatt ggacccaaca ggttaccttc cttcaattat ccttcagacc acctgtctct agtgtgtgac ttcagcttta ctgaggaatc tgatggactt tcataa. It is sometimes possible for the material contained within the vial of "CCRN4L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.