Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AASDH cdna clone

AASDH cDNA Clone

Gene Names
AASDH; LYS2; ACSF4; NRPS998; NRPS1098
Synonyms
AASDH; AASDH cDNA Clone; AASDH cdna clone
Ordering
For Research Use Only!
Sequence
atgactcttcaggaattggtgcataaggctgcctcctgttatatggacagagtagctgtatgttttgatgaatgcaacaaccagcttccagtttactacacctacaagactgtggttaatgctgcttctgaattatcaaattttctgctgttacactgtgactttcaaggaattcgggaaattggtctctactgccaacctgggatagacttaccctcttggattttaggaattctccaagtcccggctgcttatgtacctatcgagccagattcaccaccgtcattatcaactcattttatgaaaaaatgtaatctaaagtatatccttgttgaaaaaaaacaaattaatgtaagtctggatgtttcaattgttttttgcctgtattacatttatttcaattga
Sequence Length
405
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
96,217 Da
NCBI Official Full Name
Homo sapiens aminoadipate-semialdehyde dehydrogenase, mRNA
NCBI Official Synonym Full Names
aminoadipate-semialdehyde dehydrogenase
NCBI Official Symbol
AASDH
NCBI Official Synonym Symbols
LYS2; ACSF4; NRPS998; NRPS1098
NCBI Protein Information
acyl-CoA synthetase family member 4
UniProt Protein Name
Acyl-CoA synthetase family member 4
UniProt Gene Name
AASDH
UniProt Synonym Gene Names
ACSF4; U26
UniProt Entry Name
ACSF4_HUMAN

NCBI Description

This gene encodes a member of the non-ribosome peptide syntesase (NRPS) enzyme family. The encoded protein contains an AMP-binding domain, PP-binding (phosphopantetheine, or pantetheine 4'phosphate-binding) domain and the Pyrrolo-quinoline quinon (PQQ) binding domain. The protein is expressed in several adult tissues. [provided by RefSeq, Apr 2016]

Uniprot Description

AASDH: Acyl-CoA synthases catalyze the initial reaction in fatty acid metabolism, by forming a thioester with CoA. Belongs to the ATP-dependent AMP-binding enzyme family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - lysine biosynthesis; EC 1.2.1.31; Amino Acid Metabolism - lysine degradation; Ligase; Oxidoreductase

Chromosomal Location of Human Ortholog: 4q12

Molecular Function: acid-thiol ligase activity

Biological Process: fatty acid metabolic process

Research Articles on AASDH

Similar Products

Product Notes

The AASDH aasdh (Catalog #AAA1276427) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcttc aggaattggt gcataaggct gcctcctgtt atatggacag agtagctgta tgttttgatg aatgcaacaa ccagcttcca gtttactaca cctacaagac tgtggttaat gctgcttctg aattatcaaa ttttctgctg ttacactgtg actttcaagg aattcgggaa attggtctct actgccaacc tgggatagac ttaccctctt ggattttagg aattctccaa gtcccggctg cttatgtacc tatcgagcca gattcaccac cgtcattatc aactcatttt atgaaaaaat gtaatctaaa gtatatcctt gttgaaaaaa aacaaattaa tgtaagtctg gatgtttcaa ttgttttttg cctgtattac atttatttca attga. It is sometimes possible for the material contained within the vial of "AASDH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.