TTC26 cdna clone
TTC26 cDNA Clone
Gene Names
TTC26; DYF13; IFT56; dyf-13
Synonyms
TTC26; TTC26 cDNA Clone; TTC26 cdna clone
Sequence
atgatgctttcaagggccaaacctgctgtaggcagaggcgtacagcacactgacaaaagaaagaagaaaggtaggaagattccaaaactagaggagctactttcaaaaagagatttcactggagctattaccctgttggagttcaaacgtcatgttggggaagaagaagaggatactaatttgtggattggatattgtgcctttcacctgggtgactacaagagagctctggaggaatacgaaaatgctacaaaagaggaaaattgtaattctgaagtctgggtgaacctagcttgcacctacttctttcttgggatgtataaacaagctgaagcagctggatttaaagcttcaaaaagccgactccaaaaccgcctcctcttccacttggctcacaagtttaatgatgagaaaaaattgatgagctttcatcaaaatcttcaggatgtcacagaagatcaactcagtttggcctcaatccactatatgcgatctcactaccaagaagctatagatatatataagcgaatactgctagataacagggaataccttgcccttaatgtttatgtggccctctgctactacaagttggattactatgatgtgtctcaagaagttttggctgtttaccttcagcaaattcctgatagtaccatcgcactcaatcttaaagcctgtaaccattttcgcctttacaatggcagagcagctgaggcagaactcaaaagcttgatggacaatgcttcttcatcctttgaatttgctaaagaactcatcaggcacaatctggtgaataacgatttcccgtcttga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,469 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 26, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 26
NCBI Official Symbol
TTC26
NCBI Official Synonym Symbols
DYF13; IFT56; dyf-13
NCBI Protein Information
intraflagellar transport protein 56
UniProt Protein Name
Intraflagellar transport protein 56
UniProt Gene Name
TTC26
UniProt Synonym Gene Names
TPR repeat protein 26
UniProt Entry Name
IFT56_HUMAN
Uniprot Description
TTC26: May play a critical role in ciliogenesis and normal cilia function. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 7q34
Biological Process: cilium biogenesis; intraflagellar transport; smoothened signaling pathway
Research Articles on TTC26
Similar Products
Product Notes
The TTC26 ttc26 (Catalog #AAA1273202) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcttt caagggccaa acctgctgta ggcagaggcg tacagcacac tgacaaaaga aagaagaaag gtaggaagat tccaaaacta gaggagctac tttcaaaaag agatttcact ggagctatta ccctgttgga gttcaaacgt catgttgggg aagaagaaga ggatactaat ttgtggattg gatattgtgc ctttcacctg ggtgactaca agagagctct ggaggaatac gaaaatgcta caaaagagga aaattgtaat tctgaagtct gggtgaacct agcttgcacc tacttctttc ttgggatgta taaacaagct gaagcagctg gatttaaagc ttcaaaaagc cgactccaaa accgcctcct cttccacttg gctcacaagt ttaatgatga gaaaaaattg atgagctttc atcaaaatct tcaggatgtc acagaagatc aactcagttt ggcctcaatc cactatatgc gatctcacta ccaagaagct atagatatat ataagcgaat actgctagat aacagggaat accttgccct taatgtttat gtggccctct gctactacaa gttggattac tatgatgtgt ctcaagaagt tttggctgtt taccttcagc aaattcctga tagtaccatc gcactcaatc ttaaagcctg taaccatttt cgcctttaca atggcagagc agctgaggca gaactcaaaa gcttgatgga caatgcttct tcatcctttg aatttgctaa agaactcatc aggcacaatc tggtgaataa cgatttcccg tcttga. It is sometimes possible for the material contained within the vial of "TTC26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
