Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF4A2 cdna clone

EIF4A2 cDNA Clone

Gene Names
EIF4A2; DDX2B; EIF4A; EIF4F; BM-010; eIF4A-II; eIF-4A-II
Synonyms
EIF4A2; EIF4A2 cDNA Clone; EIF4A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctggtggctccgcggattataacagcagagaacatggcggcccagagggaatggaccccgatggtgtcatcgagagcaactggaatgagattgttgataactttgatgatatgaatttaaaggagtctctccttcgtggcatctatgcttacggttttgagaagccttccgctattcagcagagagctattattccctgtattaaagggtatgatgtgattgctcaagctcagtcaggtactggcaagacagccacatttgctatttccatcctgcaacagttggagattgagttcaaggagacccaagcactagtattggcccccaccagagaactggctcaacagatccaaaaggtaattctggcacttggagactatatgggagccacttgtcatgcctgcattggtggaacaaatgttcgaaatgaaatgcaaaaactgcaggctgaagcaccacatattgttgttggtacacccgggagagtgtttgatatgttaaacagaagatacctttctccaaaatggatcaaaatgtttgttttggatgaagcagatgaaatgttgagccgtggttttaaggatcaaatctatgagattttccaaaaactaaacacaagtattcaggttgtgttgctttctgccacaatgccaactgatgtgttggaagtgaccaaaaaattcatgagagatccaattcgaattctggtgaaaaaggaagaattgacccttgaaggaatcaaacagttttatattaatgttgagagagaggaatggaagttggatacactttgtgacttgtacgagacactgaccattacacaggctgttatttttctcaatacgaggcgcaaggtggactggctgactgagaagatgcatgccagagacttcacagtttctgctctgcatggtgacatggaccagaaggagagagatgttatcatgagggaattccggtcagggtcaagtcgtgttctgatcactactgacttgttggctcgcgggattgatgtgcaacaagtgtctttggttataaattatgatctacctaccaatcgtgaaaactatattcacagaattggcagagggggtcgatttgggaggaaaggtgtggctataaactttgttactgaagaagacaagaggattcttcgtgacattgagactttctacaatactacagtggaggagatgcccatgaatgtggctgaccttatttaa
Sequence Length
1227
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,489 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 4A, isoform 2, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 4A2
NCBI Official Symbol
EIF4A2
NCBI Official Synonym Symbols
DDX2B; EIF4A; EIF4F; BM-010; eIF4A-II; eIF-4A-II
NCBI Protein Information
eukaryotic initiation factor 4A-II
UniProt Protein Name
Eukaryotic initiation factor 4A-II
UniProt Gene Name
EIF4A2
UniProt Synonym Gene Names
DDX2B; EIF4F; eIF-4A-II; eIF4A-II
UniProt Entry Name
IF4A2_HUMAN

Uniprot Description

EIF4A2: ATP-dependent RNA helicase which is a subunit of the eIF4F complex involved in cap recognition and is required for mRNA binding to ribosome. In the current model of translation initiation, eIF4A unwinds RNA secondary structures in the 5'-UTR of mRNAs which is necessary to allow efficient binding of the small ribosomal subunit, and subsequent scanning for the initiator codon. Belongs to the DEAD box helicase family. eIF4A subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; EC 3.6.4.13; Translation; Translation initiation; Helicase

Chromosomal Location of Human Ortholog: 3q28

Cellular Component: cytosol; eukaryotic translation initiation factor 4F complex; perinuclear region of cytoplasm

Molecular Function: ATP-dependent RNA helicase activity; ATPase activity; helicase activity; protein binding

Biological Process: poly(A) tail shortening; RNA secondary structure unwinding; translational initiation

Research Articles on EIF4A2

Similar Products

Product Notes

The EIF4A2 eif4a2 (Catalog #AAA1273053) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctggtg gctccgcgga ttataacagc agagaacatg gcggcccaga gggaatggac cccgatggtg tcatcgagag caactggaat gagattgttg ataactttga tgatatgaat ttaaaggagt ctctccttcg tggcatctat gcttacggtt ttgagaagcc ttccgctatt cagcagagag ctattattcc ctgtattaaa gggtatgatg tgattgctca agctcagtca ggtactggca agacagccac atttgctatt tccatcctgc aacagttgga gattgagttc aaggagaccc aagcactagt attggccccc accagagaac tggctcaaca gatccaaaag gtaattctgg cacttggaga ctatatggga gccacttgtc atgcctgcat tggtggaaca aatgttcgaa atgaaatgca aaaactgcag gctgaagcac cacatattgt tgttggtaca cccgggagag tgtttgatat gttaaacaga agataccttt ctccaaaatg gatcaaaatg tttgttttgg atgaagcaga tgaaatgttg agccgtggtt ttaaggatca aatctatgag attttccaaa aactaaacac aagtattcag gttgtgttgc tttctgccac aatgccaact gatgtgttgg aagtgaccaa aaaattcatg agagatccaa ttcgaattct ggtgaaaaag gaagaattga cccttgaagg aatcaaacag ttttatatta atgttgagag agaggaatgg aagttggata cactttgtga cttgtacgag acactgacca ttacacaggc tgttattttt ctcaatacga ggcgcaaggt ggactggctg actgagaaga tgcatgccag agacttcaca gtttctgctc tgcatggtga catggaccag aaggagagag atgttatcat gagggaattc cggtcagggt caagtcgtgt tctgatcact actgacttgt tggctcgcgg gattgatgtg caacaagtgt ctttggttat aaattatgat ctacctacca atcgtgaaaa ctatattcac agaattggca gagggggtcg atttgggagg aaaggtgtgg ctataaactt tgttactgaa gaagacaaga ggattcttcg tgacattgag actttctaca atactacagt ggaggagatg cccatgaatg tggctgacct tatttaa. It is sometimes possible for the material contained within the vial of "EIF4A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.