Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR172B cdna clone

GPR172B cDNA Clone

Gene Names
SLC52A1; PAR2; RFT1; RBFVD; RFVT1; hRFT1; GPCR42; GPR172B
Synonyms
GPR172B; GPR172B cDNA Clone; GPR172B cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcacccacgctgggccgtctggtgctgacccacctgctggtggccctttttggcatgggctcctgggctgctgtgaacgggatctgggtggagctgcctgtggtggtaaaagaccttccagagggttggagcctcccctcatacctctctgtggttgtggcgctgggaaacctgggtctgctggtggtgaccctgtggaggcggctggccccgggcaagggcgagcaggtccccatccaggtggtacaggtgctgagtgtagtgggcacagccctgctggcccctctgtggcaccacgtggccccagtggcagggcagctccactctgtggccttcctaactctggccttggtgttggcaatggcctgttgtacctctaatgtcactttcctgcccttcctgagccacctgccacctcctttcttacggtctttcttcctgggtcagggtctcagtgccctactcccctgtgtgctggccctagtgcaaggtgtgggccgcctcgagtgcccaccagcgcccaccaatggcacctctgggcctcccctcgacttccctgagcgttttcctgccagcaccttcttctgggcactgactgcccttctggtcacttcagctgccgccttccggggtctcctgttgctgttgccatcactaccctctgtaaccacagggggctcagggcctgaacttcaactgggatccccaggagcagaggaggaagagaaggaggaagaagaggctttgccattgcaggagccaccgagccaggcagcaggcaccatccctggcccagaccctgaggtccatcagctgttctcagcccatggtgccttcctgctgggcctgatggccttcaccagtgccgtgaccaatggcgtgctgccttctgtgcagagcttttcctgtttgccctatgggcgcctggcctaccacctggctgtggtgctgggcagtgccgccaacccccttgcctgcttcctggccatgggcgtgctgtgcaggtccctggcagggctggttggtctttctctgctgggcatgctctttggggcctacctgatggcactggcaatcctgagcccctgcccacccctggtgggcaccactgcaggggtggtccttgtggtgctgtcgtgggtgctgtgtctgtgtgtgttctcatatgtgaaggtggctgcaagctccctgctgcatggtgggggtcggccggcattgctggcagctggtgtggccatccaagtgggctccctgcttggtgccggtgccatgttccctcccaccagcatctaccacgtgtttcaaagcagaaaggactgtgtagacccctgtggcccctga
Sequence Length
1347
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,360 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 172B, mRNA
NCBI Official Synonym Full Names
solute carrier family 52 member 1
NCBI Official Symbol
SLC52A1
NCBI Official Synonym Symbols
PAR2; RFT1; RBFVD; RFVT1; hRFT1; GPCR42; GPR172B
NCBI Protein Information
solute carrier family 52, riboflavin transporter, member 1
UniProt Protein Name
Solute carrier family 52, riboflavin transporter, member 1
UniProt Gene Name
SLC52A1
UniProt Synonym Gene Names
GPR172B; PAR2; RFT1; PERV-A receptor 2; hRFT1
UniProt Entry Name
S52A1_HUMAN

NCBI Description

Biological redox reactions require electron donors and acceptor. Vitamin B2 is the source for the flavin in flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) which are common redox reagents. This gene encodes a member of the riboflavin (vitamin B2) transporter family. Haploinsufficiency of this protein can cause maternal riboflavin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]

Uniprot Description

GPR172B: Riboflavin transporter. Riboflavin transport is Na(+)- independent but moderately pH-sensitive. Activity is strongly inhibited by riboflavin analogs, such as lumiflavin. Weakly inhibited by flavin adenine dinucleotide (FAD). In case of infection by retroviruses, acts as a cell receptor to retroviral envelopes similar to the porcine endogenous retrovirus (PERV-A). Haploinsufficiency in SLC52A1 can cause maternal riboflavin deficiency. In the newborn infant, this can lead to a transient riboflavin-responsive disorder with clinical and biochemical features of multiple acyl-CoA dehydrogenase deficiency. Belongs to the riboflavin transporter family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p13.2

Cellular Component: integral to plasma membrane

Molecular Function: riboflavin transporter activity

Biological Process: riboflavin transport

Disease: Riboflavin Deficiency

Research Articles on GPR172B

Similar Products

Product Notes

The GPR172B slc52a1 (Catalog #AAA1272302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcac ccacgctggg ccgtctggtg ctgacccacc tgctggtggc cctttttggc atgggctcct gggctgctgt gaacgggatc tgggtggagc tgcctgtggt ggtaaaagac cttccagagg gttggagcct cccctcatac ctctctgtgg ttgtggcgct gggaaacctg ggtctgctgg tggtgaccct gtggaggcgg ctggccccgg gcaagggcga gcaggtcccc atccaggtgg tacaggtgct gagtgtagtg ggcacagccc tgctggcccc tctgtggcac cacgtggccc cagtggcagg gcagctccac tctgtggcct tcctaactct ggccttggtg ttggcaatgg cctgttgtac ctctaatgtc actttcctgc ccttcctgag ccacctgcca cctcctttct tacggtcttt cttcctgggt cagggtctca gtgccctact cccctgtgtg ctggccctag tgcaaggtgt gggccgcctc gagtgcccac cagcgcccac caatggcacc tctgggcctc ccctcgactt ccctgagcgt tttcctgcca gcaccttctt ctgggcactg actgcccttc tggtcacttc agctgccgcc ttccggggtc tcctgttgct gttgccatca ctaccctctg taaccacagg gggctcaggg cctgaacttc aactgggatc cccaggagca gaggaggaag agaaggagga agaagaggct ttgccattgc aggagccacc gagccaggca gcaggcacca tccctggccc agaccctgag gtccatcagc tgttctcagc ccatggtgcc ttcctgctgg gcctgatggc cttcaccagt gccgtgacca atggcgtgct gccttctgtg cagagctttt cctgtttgcc ctatgggcgc ctggcctacc acctggctgt ggtgctgggc agtgccgcca acccccttgc ctgcttcctg gccatgggcg tgctgtgcag gtccctggca gggctggttg gtctttctct gctgggcatg ctctttgggg cctacctgat ggcactggca atcctgagcc cctgcccacc cctggtgggc accactgcag gggtggtcct tgtggtgctg tcgtgggtgc tgtgtctgtg tgtgttctca tatgtgaagg tggctgcaag ctccctgctg catggtgggg gtcggccggc attgctggca gctggtgtgg ccatccaagt gggctccctg cttggtgccg gtgccatgtt ccctcccacc agcatctacc acgtgtttca aagcagaaag gactgtgtag acccctgtgg cccctga. It is sometimes possible for the material contained within the vial of "GPR172B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.