Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUP35 cdna clone

NUP35 cDNA Clone

Gene Names
NUP35; MP44; NP44; MP-44; NUP53
Synonyms
NUP35; NUP35 cDNA Clone; NUP35 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcctttgcagtggaacctcaggggcccgcgttaggatctgaaccaatgatgctgggttcacccacatctccaaagccaggagttaatgcccagttcttacctggatttttaatgggggatttgccagctccggtgactccacaacctcgatcaattagtggcccttcagtaggagtaatggaaatgagatcacctttacttgcaggtgggtcaccaccacaaccagttgtaccagctcataaagataaaagtggcgctccaccagttagaagtatatatgatgacatttctagcccaggacttggatcaacacctttaacttcaagaagacagccaaacatttcagtaatgcagagtcctcttgttggagttacatctactcctggaacagggcaaagtatgtttagtccagcaagtatcggtcagccacgaaagacgacattatctcctgcccagttggatcctttttatactcaaggagattctttgacttcagaagatcacctcgatgactcttgggtgactgtatttgggtttcctcaagcatctgcttcctacatattactacaatttgcacagtatgggaatatcttaaaacatgtgatgtctaatacaggaaattggatgcatattcgttatcaatctaaactgcaggctcggaaagccttaagcaaagatgggaggatttttggagaatccatcatgattggtgtaaaaccatgtattgacaaaagtgttatggaaagcagtgacagatgtgctttatcatctccatctttagcctttacaccaccaatcaaaactctaggtacaccaacacaacctggaagtactcctaggatttctaccatgagacctcttgctacagcatacaaagcctctactagtgattatcaggttatttctgacagacaaacgccaaaaaaagatgaaagtcttgtatccaaagcaatggagtacatgtttggctggtag
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,142 Da
NCBI Official Full Name
Homo sapiens nucleoporin 35kDa, mRNA
NCBI Official Synonym Full Names
nucleoporin 35
NCBI Official Symbol
NUP35
NCBI Official Synonym Symbols
MP44; NP44; MP-44; NUP53
NCBI Protein Information
nucleoporin NUP53
UniProt Protein Name
Nucleoporin NUP53
Protein Family
UniProt Gene Name
NUP35
UniProt Synonym Gene Names
MP44; NUP53; MP-44
UniProt Entry Name
NUP53_HUMAN

NCBI Description

This gene encodes a member of the nucleoporin family. The encoded protein contains two membrane binding regions, is localized to the nuclear rim, and is part of the nuclear pore complex. All molecules entering or leaving the nucleus either diffuse through or are actively transported by the nuclear pore complex. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 7 and 10. [provided by RefSeq, Dec 2013]

Uniprot Description

NUP35: Functions as a component of the nuclear pore complex (NPC). NPC components, collectively referred to as nucleoporins (NUPs). Can play the role of both NPC structural components and of docking or interaction partners for transiently associated nuclear transport factors. May play a role in the association of MAD1 with the NPC. Belongs to the Nup53 family.

Protein type: Nucleoporin

Chromosomal Location of Human Ortholog: 2q32.1

Cellular Component: intermediate filament cytoskeleton; intracellular membrane-bound organelle; nuclear envelope; nuclear membrane; nucleoplasm; plasma membrane

Molecular Function: nucleocytoplasmic transporter activity; phospholipid binding; protein binding; single-stranded DNA binding

Biological Process: mitotic nuclear envelope disassembly; mRNA export from nucleus; NLS-bearing substrate import into nucleus; nuclear pore organization and biogenesis; protein sumoylation; regulation of transcription, DNA-dependent; RNA-mediated gene silencing; tRNA export from nucleus; viral reproduction; viral transcription

Research Articles on NUP35

Similar Products

Product Notes

The NUP35 nup35 (Catalog #AAA1270215) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcct ttgcagtgga acctcagggg cccgcgttag gatctgaacc aatgatgctg ggttcaccca catctccaaa gccaggagtt aatgcccagt tcttacctgg atttttaatg ggggatttgc cagctccggt gactccacaa cctcgatcaa ttagtggccc ttcagtagga gtaatggaaa tgagatcacc tttacttgca ggtgggtcac caccacaacc agttgtacca gctcataaag ataaaagtgg cgctccacca gttagaagta tatatgatga catttctagc ccaggacttg gatcaacacc tttaacttca agaagacagc caaacatttc agtaatgcag agtcctcttg ttggagttac atctactcct ggaacagggc aaagtatgtt tagtccagca agtatcggtc agccacgaaa gacgacatta tctcctgccc agttggatcc tttttatact caaggagatt ctttgacttc agaagatcac ctcgatgact cttgggtgac tgtatttggg tttcctcaag catctgcttc ctacatatta ctacaatttg cacagtatgg gaatatctta aaacatgtga tgtctaatac aggaaattgg atgcatattc gttatcaatc taaactgcag gctcggaaag ccttaagcaa agatgggagg atttttggag aatccatcat gattggtgta aaaccatgta ttgacaaaag tgttatggaa agcagtgaca gatgtgcttt atcatctcca tctttagcct ttacaccacc aatcaaaact ctaggtacac caacacaacc tggaagtact cctaggattt ctaccatgag acctcttgct acagcataca aagcctctac tagtgattat caggttattt ctgacagaca aacgccaaaa aaagatgaaa gtcttgtatc caaagcaatg gagtacatgt ttggctggta g. It is sometimes possible for the material contained within the vial of "NUP35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.