Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC23B cdna clone

SEC23B cDNA Clone

Gene Names
SEC23B; CWS7; CDAII; CDAN2; CDA-II; HEMPAS
Synonyms
SEC23B; SEC23B cDNA Clone; SEC23B cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacatacctggagttcatccagcagaatgaagaacgggatggtgtgcgttttagttggaacgtgtggccttccagccggctggaggctacaagaatggttgtacccctggcttgtctccttactcctttgaaagaacgtccagacctacctcctgtacaatatgaacctgtgctttgcagcaggccaacttgtaaagctgttctcaacccactttgtcaggttgattatcgagcaaaactttgggcctgtaatttctgttttcaaagaaatcagtttcctccagcttatggaggcatatctgaggtgaatcaacctgccgaattgatgccccagttttctacaattgagtacgtgatacagcgaggtgctcagtcccctctgatctttctctatgtggttgacacatgcctggaggaagatgaccttcaagcactcaaagagtccctgcagatgtccctgagtcttcttcctccagatgctctggtgggtctgatcacatttggaaggatggtgcaggttcatgagctaagctgtgaaggaatctccaaaagttatgtcttccgagggaccaaggatttaactgcaaagcaaatacaggatatgttgggcctgaccaagccagccatgcccatgcagcaagcacgacctgcacaaccacaggagcacccttttgcttcaagcagatttctgcagcctgttcacaagattgatatgaacctcactgatcttcttggggagctacagagggacccatggccagtaactcaggggaagagacctttgcgatccactggtgtggctttgtccattgctgttggcttgctggagggcacttttccaaacacaggagccaggatcatgctgtttactggaggtccccctacccaagggcctggcatggtggttggagatgaattaaagattcctattcgttcttggcatgatattgagaaagataatgcacgattcatgaaaaaggcaaccaagcactatgagatgcttgctaatcgaacagctgcaaatggtcactgcattgatatttatgcttgtgcccttgatcaaactggacttttggagatgaagtgttgtgcaaatcttactggaggctacgtggtaatgggagattctttcaacacttctctcttcaagcagacattccaaagaatctttactaaagattttaatggagatttccgaatggcatttggtgctactttggacgtaaagacctctcgggaactgaagattgcaggagccattggtccatgcgtatctctgaatgtgaaaggactgtgtgtgtcagaaaatgagcttggtgttggtggcacgagtcagtggaaaatctgtggcctagatcctacatctacacttggcatctattttgaagttgtcaatcagcacaacaccccgatcccccaaggaggcagaggagccatccagtttgtcacgcattatcagcactccagcacccagagacgcatccgcgtgaccaccatcgcccgaaattgggcagatgtacagagtcagctcaggcacatagaagcagcatttgaccaggaggctgcggcagtgttgatggcacggcttggggtgttccgagcggagtcagaggaggggcccgatgtgctccggtggctggaccgacaactcatccgactgtgtcaaaagtttggacagtataacaaagaagaccccacttcttttaggttatcagattccttttctctatatcctcagtttatgttccatctgagaagatctccatttcttcaagtgtttaacaacagtcctgatgagtcgtcatattacagacatcattttgcccggcaggacctgacccagtccctcatcatgatccagcccattctctactcttactcctttcatgggccaccagagccagtactcttggatagcagcagcattctagctgacagaattttgctgatggatactttctttcaaattgtcatttatcttggtgagaccatagcccagtggcgtaaagctggctaccaggacatgcccgagtatgaaaacttcaagcaccttctgcaggcaccactggatgatgctcaagaaattctgcaagcacgcttcccgatgccacgttacatcaacacggagcatggaggcagtcaggctcgattccttttgtccaaagtgaacccatctcagacacacaataacctgtatgcttggggacaggaaactggagcacccatcctaactgatgatgttagcctgcaggtgttcatggaccatttgaagaagctggctgtctccagtgcctgttaa
Sequence Length
2304
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,479 Da
NCBI Official Full Name
Homo sapiens Sec23 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
Sec23 homolog B, coat complex II component
NCBI Official Symbol
SEC23B
NCBI Official Synonym Symbols
CWS7; CDAII; CDAN2; CDA-II; HEMPAS
NCBI Protein Information
protein transport protein Sec23B
UniProt Protein Name
Protein transport protein Sec23B
Protein Family
UniProt Gene Name
SEC23B
UniProt Entry Name
SC23B_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]

Uniprot Description

SEC23B: Component of the COPII coat, that covers ER-derived vesicles involved in transport from the endoplasmic reticulum to the Golgi apparatus. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the Golgi complex. COPII is composed of at least five proteins: the Sec23/24 complex, the Sec13/31 complex and Sar1. Belongs to the SEC23/SEC24 family. SEC23 subfamily.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 20p11.23

Cellular Component: endomembrane system; endoplasmic reticulum; Golgi apparatus; intracellular membrane-bound organelle; membrane

Molecular Function: protein binding

Biological Process: vesicle-mediated transport

Disease: Anemia, Congenital Dyserythropoietic, Type Ii; Cowden Syndrome 7

Research Articles on SEC23B

Similar Products

Product Notes

The SEC23B sec23b (Catalog #AAA1268663) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacat acctggagtt catccagcag aatgaagaac gggatggtgt gcgttttagt tggaacgtgt ggccttccag ccggctggag gctacaagaa tggttgtacc cctggcttgt ctccttactc ctttgaaaga acgtccagac ctacctcctg tacaatatga acctgtgctt tgcagcaggc caacttgtaa agctgttctc aacccacttt gtcaggttga ttatcgagca aaactttggg cctgtaattt ctgttttcaa agaaatcagt ttcctccagc ttatggaggc atatctgagg tgaatcaacc tgccgaattg atgccccagt tttctacaat tgagtacgtg atacagcgag gtgctcagtc ccctctgatc tttctctatg tggttgacac atgcctggag gaagatgacc ttcaagcact caaagagtcc ctgcagatgt ccctgagtct tcttcctcca gatgctctgg tgggtctgat cacatttgga aggatggtgc aggttcatga gctaagctgt gaaggaatct ccaaaagtta tgtcttccga gggaccaagg atttaactgc aaagcaaata caggatatgt tgggcctgac caagccagcc atgcccatgc agcaagcacg acctgcacaa ccacaggagc acccttttgc ttcaagcaga tttctgcagc ctgttcacaa gattgatatg aacctcactg atcttcttgg ggagctacag agggacccat ggccagtaac tcaggggaag agacctttgc gatccactgg tgtggctttg tccattgctg ttggcttgct ggagggcact tttccaaaca caggagccag gatcatgctg tttactggag gtccccctac ccaagggcct ggcatggtgg ttggagatga attaaagatt cctattcgtt cttggcatga tattgagaaa gataatgcac gattcatgaa aaaggcaacc aagcactatg agatgcttgc taatcgaaca gctgcaaatg gtcactgcat tgatatttat gcttgtgccc ttgatcaaac tggacttttg gagatgaagt gttgtgcaaa tcttactgga ggctacgtgg taatgggaga ttctttcaac acttctctct tcaagcagac attccaaaga atctttacta aagattttaa tggagatttc cgaatggcat ttggtgctac tttggacgta aagacctctc gggaactgaa gattgcagga gccattggtc catgcgtatc tctgaatgtg aaaggactgt gtgtgtcaga aaatgagctt ggtgttggtg gcacgagtca gtggaaaatc tgtggcctag atcctacatc tacacttggc atctattttg aagttgtcaa tcagcacaac accccgatcc cccaaggagg cagaggagcc atccagtttg tcacgcatta tcagcactcc agcacccaga gacgcatccg cgtgaccacc atcgcccgaa attgggcaga tgtacagagt cagctcaggc acatagaagc agcatttgac caggaggctg cggcagtgtt gatggcacgg cttggggtgt tccgagcgga gtcagaggag gggcccgatg tgctccggtg gctggaccga caactcatcc gactgtgtca aaagtttgga cagtataaca aagaagaccc cacttctttt aggttatcag attccttttc tctatatcct cagtttatgt tccatctgag aagatctcca tttcttcaag tgtttaacaa cagtcctgat gagtcgtcat attacagaca tcattttgcc cggcaggacc tgacccagtc cctcatcatg atccagccca ttctctactc ttactccttt catgggccac cagagccagt actcttggat agcagcagca ttctagctga cagaattttg ctgatggata ctttctttca aattgtcatt tatcttggtg agaccatagc ccagtggcgt aaagctggct accaggacat gcccgagtat gaaaacttca agcaccttct gcaggcacca ctggatgatg ctcaagaaat tctgcaagca cgcttcccga tgccacgtta catcaacacg gagcatggag gcagtcaggc tcgattcctt ttgtccaaag tgaacccatc tcagacacac aataacctgt atgcttgggg acaggaaact ggagcaccca tcctaactga tgatgttagc ctgcaggtgt tcatggacca tttgaagaag ctggctgtct ccagtgcctg ttaa. It is sometimes possible for the material contained within the vial of "SEC23B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.