Western Blot (WB) (Western blot analysis of Human Cervical cancer cell line (HeLa) lysate showing detection of 134 kDa EGF protein using Rabbit Anti-EGF Polyclonal Antibody . Lane 1: Molecular Weight Ladder (MW). Lane 2: HeLa . Load: 10 ug. Block: 5% Skim Milk powder in TBST. Primary Antibody: Rabbit Anti-EGF Polyclonal Antibody at 1:1000 for 2 hours at RT with shaking. Secondary Antibody: Goat Anti-Rabbit IgG: HRP at 1:5000 for 1 hour at RT. Color Development: ECL solution for 5 min at RT. Predicted/Observed Size: 134 kDa. Other Band(s): 80 kDa, 55 kDa .)
Western Blot (WB) (Western blot analysis of Human Cervical cancer cell line (HeLa) lysate showing detection of ~104.7 kDa ROR2 protein using Rabbit Anti-ROR2 Polyclonal Antibody (SPC-739). Lane 1: Molecular Weight Ladder (MW). Lane 2: Cervical Cancer cell line (HeLa) lysate. Load: 10 ug. Block: 5% Skim Milk in 1X TBST. Primary Antibody: Rabbit Anti-ROR2 Polyclonal Antibody (SPC-739) at 1:1000 for 2 hours at RT. Secondary Antibody: Goat Anti-Rabbit HRP:IgG at 1:4000 for 1 hour at RT. Color Development: ECL solution for 5 min at RT. Predicted/Observed Size: ~104.7 kDa. Other Band(s): ~60, 35 kDa degradation products.)
Western Blot (WB) (Western blot analysis of Human Cervical cancer cell line (HeLa) lysate showing detection of ~104.7 kDa ROR2 protein using Rabbit Anti-ROR2 Polyclonal Antibody (SPC-739). Lane 1: Molecular Weight Ladder (MW). Lane 2: Cervical Cancer cell line (HeLa) lysate. Load: 10 ug. Block: 5% Skim Milk in 1X TBST. Primary Antibody: Rabbit Anti-ROR2 Polyclonal Antibody (SPC-739) at 1:1000 for 2 hours at RT. Secondary Antibody: Goat Anti-Rabbit HRP:IgG at 1:4000 for 1 hour at RT. Color Development: ECL solution for 5 min at RT. Predicted/Observed Size: ~104.7 kDa. Other Band(s): ~60, 35 kDa degradation products.)
SDS-Page (Recombinant Human AGER/RAGE Protein was determined by SDS-PAGE with Coomassie Blue, showing a band at 100 kDa.)
Western Blot (WB) (Western blot analysis of Human Cervical cancer cell line (HeLa) lysate showing detection of ~104.7 kDa ROR2 protein using Rabbit Anti-ROR2 Polyclonal Antibody (SPC-739). Lane 1: Molecular Weight Ladder (MW). Lane 2: Cervical Cancer cell line (HeLa) lysate. Load: 10 ug. Block: 5% Skim Milk in 1X TBST. Primary Antibody: Rabbit Anti-ROR2 Polyclonal Antibody (SPC-739) at 1:1000 for 2 hours at RT. Secondary Antibody: Goat Anti-Rabbit HRP:IgG at 1:4000 for 1 hour at RT. Color Development: ECL solution for 5 min at RT. Predicted/Observed Size: ~104.7 kDa. Other Band(s): ~60, 35 kDa degradation products.)
SDS-Page (Recombinant KAT6A / MOZ (488-778) protein gel 10% SDS-PAGE gel with Coomassie staining MW: 35.5 kDa Purity: > 95%)
Western Blot (WB) (Recombinant KAT6A / MOZ (488-778) protein activity assay 0.5 ug Histone H3.1 was incubated with 0 ug (-), 0.1 ug (+), 0.2 ug (++), 0.4 ug (+++) KAT6A / MOZ (488-778) protein in a 20 ul reaction system containing 50 mM Tris-HCl pH 8.6, 2 mM MgCl2, 1 mM TCEP, 0.02% Triton X-100 and 20 uM Acetyl-CoA for 2 hr at RT. Reaction products were detected by Western blot using H3 pan-acetyl antibody .)
SDS-Page (Recombinant METTL3 / METTL14 complex, protein gel. Recombinant METTL3 / METTL14 complex was run on a 10% SDS-PAGE gel and stained with Coomassie Blue. MW: METTL3: 64.5 kDa, MW: METTL14, N-DYKDDDDK: 53.3 kDa. Purity: >85%)
Testing Data (MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)
Testing Data (MTase-Glo assay for METTL3 / METTL14 Complex m6A methyltransferase activity 1 ?M Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 ?M SAM was incubated with different concentrations of METTL3 / METTL14 Complex in an 8 ul reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour. 5xMTase-Glo Reagent was added to the products and incubated for 30 min, then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. SAH standard curve (0-1 uM) was performed following the same protocol.)
Western Blot (WB) (Figure 1. Western blot analysis of E2F4 using anti-E2F4 antibody (M01920).Electrophoresis was performed on a 5-20% SDS-PAGE gel at 70V (Stacking gel)/90V (Resolving gel) for 2-3 hours. The sample well of each lane was loaded with 50ug of sample under reducing conditions.After Electrophoresis, proteins were transferred to a Nitrocellulose membrane at 150mA for 50-90 minutes. Blocked the membrane with 5% Non-fat Milk/TBS for 1.5 hour at RT. The membrane was incubated with rabbit anti-E2F4 antigen affinity purified polyclonal antibody at 0.5 ug/mL overnight at 4° C, then washed with TBS-0.1%Tween 3 times with 5 minutes each and probed with a goat anti-Rabbit IgG IgG-HRP secondary antibody at a dilution of 1:10000 for 1.5 hour at RT. The signal is developed using an Enhanced Chemiluminescent detection (ECL) kit with Tanon 5200 system. A specific band was detected for E2F4. )
Typical Testing Data/Standard Curve (for reference only) (Representative Standard Curve)
Typical Testing Data/Standard Curve (for reference only) (Representative Standard Curve)